ID: 1096850253

View in Genome Browser
Species Human (GRCh38)
Location 12:54430900-54430922
Sequence TAGGGGAAAGGCTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096850243_1096850253 22 Left 1096850243 12:54430855-54430877 CCAGGAATAAACAAATAATTGGT No data
Right 1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG No data
1096850245_1096850253 -3 Left 1096850245 12:54430880-54430902 CCAGGATGAGCTCAGTGATCTAG No data
Right 1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096850253 Original CRISPR TAGGGGAAAGGCTCTGTAGG GGG Intergenic
No off target data available for this crispr