ID: 1096859077

View in Genome Browser
Species Human (GRCh38)
Location 12:54510130-54510152
Sequence TGTAGCTAAAAAATCATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096859077 Original CRISPR TGTAGCTAAAAAATCATGGT TGG Intronic
900820674 1:4885168-4885190 TGTAGCTATATTACCATGGTGGG + Intergenic
903346576 1:22688698-22688720 TGTAGAAAAATATTCATGGTTGG + Intergenic
903911325 1:26728004-26728026 TGTAGCTCTAAAATTATGATAGG + Intronic
906424601 1:45700071-45700093 TGGAGCCAAAAAATCATGGCTGG + Exonic
906627696 1:47338783-47338805 TTTAGTTATAAAATCATGATGGG + Intronic
908343811 1:63210826-63210848 TGTAGCTAAAAAAACAAAATTGG + Intergenic
909007201 1:70290856-70290878 TGTATCTAAATAAAAATGGTAGG - Intronic
909388794 1:75093326-75093348 TGTTACTAAAAAATCATAGATGG - Intergenic
909458738 1:75882953-75882975 TGTACTTTAAAAATCATAGTTGG - Intronic
909873599 1:80777013-80777035 TGTAGCATAAAACTCATGGATGG - Intergenic
911424439 1:97689253-97689275 TGCAGCTAAAAAAAGATAGTTGG + Intronic
911476068 1:98373919-98373941 TGTAGCTTAATAATAATGATAGG + Intergenic
912247953 1:107980388-107980410 TGTAGCTCAGAAATCAAGATAGG + Intergenic
913150719 1:116040069-116040091 AGGTGCTAAAAAATAATGGTGGG - Intronic
917158718 1:172032903-172032925 TGATGCTAAAAAATTATCGTGGG + Intronic
917683702 1:177394560-177394582 TTTAGATAAGAAATCATGCTGGG + Intergenic
918857001 1:189769267-189769289 TGTTTCTAAAAAGTCATTGTTGG - Intergenic
920328416 1:205185507-205185529 TGTAGCTTAAAAAACACTGTTGG - Intronic
920624295 1:207580739-207580761 TGTAGCTTTAAAATAAAGGTAGG + Intronic
921537405 1:216369207-216369229 TTTAGCTTAAAAATTATGGATGG - Intronic
922761848 1:228137937-228137959 TGTTTTTAAAAAATCATGGGAGG + Intergenic
1063984592 10:11489062-11489084 TTTATCTAAACAATCAAGGTAGG - Intronic
1064790543 10:18953207-18953229 AATAGCTTAAATATCATGGTAGG - Intergenic
1068977119 10:63022130-63022152 GGTAGCTAAAAAATACTTGTTGG + Intergenic
1069507181 10:69011061-69011083 TGTAAGTAAAAACTCATAGTGGG + Intronic
1070375439 10:75826145-75826167 TGTAGCCAATAAATCACAGTAGG - Intronic
1071282977 10:84119585-84119607 TGTAGTTAATAAATCACTGTTGG + Intergenic
1073803585 10:107070545-107070567 TGTAGCCACCAAATCATAGTAGG - Intronic
1074389062 10:113041869-113041891 TGTAGCTAAAAAATAAATGTGGG - Intronic
1078302193 11:10143426-10143448 TATAGGTAAAAATTCATGGGAGG - Intronic
1079691375 11:23421770-23421792 TATAGCAACAAAATCATGTTGGG + Intergenic
1081296502 11:41396323-41396345 TGTAGCAAAAAAATTAAGATAGG + Intronic
1081340457 11:41921262-41921284 TGTAGCAGAAAAATAATAGTAGG - Intergenic
1081947272 11:47008263-47008285 TGCAGATAAAAAATCAGAGTTGG - Intronic
1085234083 11:74998563-74998585 TGTAGGTAAAAAAGCAGGGTAGG - Intronic
1087456664 11:98395404-98395426 TGTAGTTAATAAATCACTGTTGG + Intergenic
1087481868 11:98712161-98712183 AGTAGCTAATAAATTATAGTGGG + Intergenic
1089855641 11:121542087-121542109 TTCAGCTAAAAAATAATGGATGG - Intronic
1089928702 11:122286614-122286636 TGTGGCTAAAAAATCAAATTAGG - Intergenic
1092592011 12:9960860-9960882 GGTAGGGAAAAAATCATGCTGGG - Intronic
1093356902 12:18177511-18177533 TGTAGTTAATAAATCACTGTTGG - Intronic
1093638333 12:21497281-21497303 TGTAGCTATAACCTCATGGTGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095745096 12:45649353-45649375 TGTAGCTAAAAAATTTTGTCAGG + Intergenic
1096859077 12:54510130-54510152 TGTAGCTAAAAAATCATGGTTGG + Intronic
1099194830 12:79603469-79603491 TCTACCTAAAAAGTCATGGATGG - Intronic
1107714481 13:43186711-43186733 TGTAGCTAATAAAATCTGGTTGG - Intergenic
1108853038 13:54758936-54758958 TGCAGCTAGAAAATCAGGGGAGG - Intergenic
1109434851 13:62285535-62285557 TGTAGGGAAAAAGTCATGGAAGG - Intergenic
1109564507 13:64094668-64094690 TTTAGCTAAAATATCAAAGTGGG + Intergenic
1109909339 13:68889780-68889802 TGTAGTTAATAAATCACTGTTGG + Intergenic
1110155869 13:72315412-72315434 ATTAGCTAATAAATGATGGTAGG - Intergenic
1110976544 13:81843177-81843199 TGTAGCTGAAAAATCATTACAGG - Intergenic
1111697412 13:91642260-91642282 TGTAACTCAAAAATGATAGTTGG + Intronic
1112118719 13:96385991-96386013 TTTAGCTATAAAATCATGTTAGG + Intronic
1112477162 13:99741810-99741832 TCTAGTTGAAAAAGCATGGTAGG + Intronic
1112760111 13:102686118-102686140 TTTATCTAAAAATTCATAGTCGG + Exonic
1113032073 13:106004830-106004852 TTTATTTAAAAAGTCATGGTAGG - Intergenic
1115793670 14:36908369-36908391 TCTATTTAAAAAATGATGGTGGG + Intronic
1117179374 14:53176759-53176781 TGTAGTTAATAAATCACTGTTGG + Intergenic
1120240020 14:81939191-81939213 TGTAACTAAGAAATCAACGTTGG + Intergenic
1121582876 14:95044295-95044317 TGTGGCTGAAGAATCCTGGTTGG - Intergenic
1128182193 15:65613785-65613807 TGTAGATGAAAAATCATCTTGGG - Intronic
1130925233 15:88380575-88380597 TGTAGGTAAAGAATTAAGGTAGG + Intergenic
1131589548 15:93733339-93733361 TGCAGTTAAAAAAACATGATAGG - Intergenic
1132144061 15:99416453-99416475 TGTAGCCAAATAATCTTGGAAGG + Intergenic
1136064022 16:27746780-27746802 TGGAGCTGAAAGATCATGGTGGG + Intronic
1138769175 16:59642341-59642363 TGTACCTAAAAAATCATACTGGG + Intergenic
1139755612 16:69140797-69140819 TGTAGCATAAAAAGCATGCTAGG - Intronic
1141959431 16:87394569-87394591 TGTAGCTAAAGAAACTGGGTGGG + Intronic
1143019964 17:3912251-3912273 TGTAACTGAAAAATCAGTGTGGG - Intronic
1146039270 17:29435345-29435367 TTTTGTTAAAAAATCATGATAGG + Intronic
1146715221 17:35080344-35080366 TGAAGGTAAAAAAGCATGGGAGG + Intronic
1147850372 17:43437727-43437749 TGAAGATAAAAAATCAGGGTTGG - Intergenic
1152062866 17:78091792-78091814 TGTAGCTAAGATCTAATGGTTGG - Intronic
1153175763 18:2371341-2371363 TGAAGCAATAAAATCATTGTTGG + Intergenic
1155043463 18:22084095-22084117 TGCAGGTGAAAAATAATGGTTGG + Intergenic
1158004749 18:52659760-52659782 TGTAGTTAAAAAATTAAAGTGGG + Intronic
1161187741 19:2933355-2933377 TGTACCTAAAAATTCAGAGTAGG - Exonic
1164884473 19:31766304-31766326 TGTAGTTAAAAAATCAATTTGGG - Intergenic
1167846996 19:52172814-52172836 CGTCCCTAAAAAATCATTGTTGG + Intergenic
925297856 2:2790034-2790056 TTTGGCTAGAAATTCATGGTCGG - Intergenic
925352750 2:3213084-3213106 AAGAGCTAAAAAAACATGGTAGG + Intronic
925664053 2:6234216-6234238 TGAAGCTAAAATATCATGCTGGG - Intergenic
926513616 2:13813061-13813083 TGTTGTTAAAAAAAAATGGTTGG - Intergenic
928018265 2:27679745-27679767 TGTCTGTAAAAAATGATGGTGGG + Intronic
928027604 2:27752825-27752847 TGTAGCTAATAAGTTATGGGAGG - Intergenic
928756649 2:34534330-34534352 TGTAAAAAAAAAATCATTGTGGG - Intergenic
932342455 2:70974910-70974932 TGAAACTAAAGAATCATGCTTGG - Intronic
933468248 2:82684504-82684526 TGTAGCTCTAAAATGGTGGTTGG + Intergenic
937266341 2:120616936-120616958 TGTAACTAACACATCATGGAAGG - Intergenic
939621455 2:144424196-144424218 TGAAGCTAAAAAATTACAGTGGG - Intronic
940033296 2:149287596-149287618 TGGAGATAAAAAGTCAGGGTTGG - Intergenic
940377699 2:152974615-152974637 TGATGCTACAAAATCATGCTTGG + Intergenic
944654808 2:201866929-201866951 TGTAGCTACAAAATAGAGGTGGG + Intronic
945252515 2:207776556-207776578 TATAGATGAAAAATCATGGCTGG + Intergenic
945460687 2:210104466-210104488 TGTAGCTAAAATAACATGTATGG + Intronic
1169667077 20:8049580-8049602 TGTATCTAAAAAACAATGGTAGG + Intergenic
1177900843 21:26913417-26913439 TGCAGCTAAAAATTCTTTGTTGG - Intergenic
1184170167 22:42754177-42754199 TGTAGCTAAAAATACATTATTGG + Intergenic
950283113 3:11723780-11723802 AGTAGCTAACAAATAAAGGTAGG + Intergenic
950396982 3:12741135-12741157 AGTGGCTCAACAATCATGGTGGG - Intronic
952637237 3:35546696-35546718 TTTTGTTAAAAAATCATGATAGG + Intergenic
957952461 3:87144030-87144052 TGAGGATAAAAACTCATGGTTGG + Intergenic
958666241 3:97141212-97141234 TGTAGCCATACAATCATAGTGGG + Intronic
959790724 3:110358046-110358068 TGTGGTTAGAAAATCATCGTTGG + Intergenic
960394741 3:117122558-117122580 TGTAGTTAATAAAGCATGATTGG - Intronic
960720152 3:120617704-120617726 TGTGGTTAAAAAATCACTGTTGG + Intergenic
964423487 3:156529388-156529410 TGCACCTTAAAAATGATGGTTGG + Intronic
965416100 3:168394818-168394840 TGTAGCTAAAATTGTATGGTTGG - Intergenic
965513676 3:169597558-169597580 TGTCTTTAAAAAATCATGTTGGG + Intronic
965727433 3:171733109-171733131 TGTAGCTAAAAAATGCTTTTTGG + Intronic
965847422 3:172980479-172980501 TGGAGCTATAAGATCATGTTAGG + Intronic
966631164 3:182076603-182076625 TTCTGCTACAAAATCATGGTGGG + Intergenic
976069744 4:81227750-81227772 TGTACCTAACACATCATGGGTGG + Intergenic
976172971 4:82323758-82323780 TATAGCCAAAAAATAATGTTTGG - Intergenic
976878450 4:89887643-89887665 TGTAGTTTAAAAATCAATGTAGG - Intronic
976930113 4:90556180-90556202 TGTAGCCAAAAACTCATACTGGG + Intronic
977416215 4:96735406-96735428 TGTAACTAACAAACCATGCTTGG + Intergenic
977988079 4:103409021-103409043 TGTAAATAAGAAATCAGGGTAGG - Intergenic
978200451 4:106018939-106018961 TGCAGATAAAAAATTAAGGTAGG + Intergenic
978342942 4:107737022-107737044 TGTGGCACAGAAATCATGGTGGG - Intergenic
981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG + Intronic
983814774 4:172109850-172109872 TGTAGCATACAAATCTTGGTGGG + Intronic
984776427 4:183485052-183485074 TGTTGCAAAAAAATCTTGATAGG - Intergenic
986772068 5:10983472-10983494 CTTAGGTAAAAAATCATGGGTGG - Intronic
988205250 5:28125900-28125922 TGTAGAAAAAAAATTATAGTTGG + Intergenic
989476295 5:41877512-41877534 TGTAGCCAAAATATCATACTTGG - Intergenic
992331335 5:75719855-75719877 TGTATCTGAAAAATGAGGGTAGG + Intergenic
992924218 5:81564656-81564678 TTTAGCTAAAAATTCATGCAGGG + Intronic
992927576 5:81605615-81605637 TGAAGTTAAAAAATCCTAGTAGG - Intronic
993288212 5:86029770-86029792 TGTGGATAAAAAATCATTGAAGG + Intergenic
994028431 5:95113186-95113208 TATAACTAAAAAATTAGGGTAGG + Intronic
994173087 5:96679999-96680021 TGTAGCTAAAATATAATTATTGG + Intronic
994547996 5:101192619-101192641 TGTAGCAAATAAAGCATGGATGG + Intergenic
995237609 5:109848007-109848029 TGTAGATAAAAAATAATGACAGG + Intronic
996408844 5:123134204-123134226 TGTAGTAATAAAATCATGCTGGG - Intronic
998938465 5:147255762-147255784 TGTAGTTAATAAATCACTGTTGG + Intronic
999329720 5:150664265-150664287 TTCAGCTACAAAATCAGGGTAGG - Intronic
999953807 5:156678440-156678462 TGCACCAAAAAAATCATGGAAGG + Intronic
1004795519 6:19079411-19079433 TGGGGCTTAAAAATTATGGTGGG - Intergenic
1004862008 6:19813945-19813967 TGTAGACAAATAATCATGGAAGG + Intergenic
1007919664 6:45594946-45594968 TGTAGTTAAAAAATTATTTTAGG + Intronic
1010467592 6:76187324-76187346 TATAGCAAAAAAGTCATGTTTGG + Intergenic
1012869838 6:104659560-104659582 GGTAGCAAAAAAACCATAGTGGG - Intergenic
1013703666 6:112806158-112806180 TATAGCTAAAAAATATTGTTTGG - Intergenic
1015048102 6:128803272-128803294 TGTAGGTAAAATAGAATGGTGGG - Intergenic
1015858940 6:137655646-137655668 TGTGGATATAAAACCATGGTTGG + Intergenic
1016233260 6:141831753-141831775 TGTTAAAAAAAAATCATGGTAGG - Intergenic
1020491025 7:8784514-8784536 TGTATTAAAAAAATCATGGCAGG - Intergenic
1020655900 7:10927690-10927712 TGTAGTTAATAAATCACTGTTGG - Intergenic
1021643061 7:22759622-22759644 TGTAGCTTAAAAATAAAGGATGG - Intergenic
1024791409 7:52968618-52968640 TTTAGGTAAAAAATCAAGGATGG + Intergenic
1027339930 7:77195955-77195977 TGTATTTAAAAAATAATTGTTGG - Exonic
1030126581 7:106158263-106158285 TGTATCAAAAAAATTAGGGTGGG - Intergenic
1032350042 7:131153632-131153654 TGTAGCTACAAAATGAAAGTAGG + Intronic
1033506679 7:142009906-142009928 TGTAGCTGAAAGAGGATGGTGGG + Intronic
1033535127 7:142305183-142305205 TGTTGCTAAAAAATGACTGTGGG + Intergenic
1038162588 8:25054292-25054314 TGTAGCTCAAAATTCATGAGAGG - Intergenic
1038348896 8:26758477-26758499 TAAAGCTATAAAATCATAGTAGG - Intronic
1039312758 8:36336702-36336724 TGTATCTAAAAAGTCATAATTGG - Intergenic
1040814013 8:51487498-51487520 TTTGGCTAAAAATTTATGGTTGG - Intronic
1040927951 8:52705249-52705271 TGTATCTATACAATAATGGTGGG + Intronic
1043781122 8:84336412-84336434 TGTATTTAAAAAATGATGTTTGG + Intronic
1044184432 8:89235231-89235253 TGTAGTTAATAAATCACTGTTGG + Intergenic
1044454270 8:92374529-92374551 AGTAACAAAAAAATCATTGTTGG - Intergenic
1046329672 8:112698578-112698600 TGTACTTAAAGAATGATGGTGGG + Intronic
1046880677 8:119304184-119304206 TGTAGTTACACAAACATGGTTGG - Intergenic
1051593472 9:18799873-18799895 TGTAGCTACTAAATCATGATGGG - Intronic
1059140688 9:111850331-111850353 TATAGCTTAAAATTCAAGGTGGG + Intergenic
1060019792 9:120119188-120119210 GTTAGATAAAAGATCATGGTGGG - Intergenic
1060068703 9:120527725-120527747 TGAAGCTAAAAATTCAGGGTAGG + Intronic
1186036384 X:5428203-5428225 TGTATCTAAATAAATATGGTTGG + Intergenic
1188279270 X:28244074-28244096 TGTAGCTTCAAATTCATTGTTGG - Intergenic
1188870223 X:35363363-35363385 TGAAGCTTAAAAATTATTGTAGG + Intergenic
1189833701 X:45000195-45000217 TGTAGTTAATAAATTATTGTTGG + Intronic
1191047164 X:56150800-56150822 TGTAGATAAAACATCTTGGAAGG - Intergenic
1193364535 X:80615851-80615873 TATAGCTAGAAAATCTTGATTGG + Intergenic
1193704199 X:84801304-84801326 TGTCTCTAAAAAATCATGCTGGG - Intergenic
1194812221 X:98400531-98400553 TGTAGCTAAGATGTTATGGTTGG - Intergenic
1195913295 X:109911303-109911325 TATGGCTGAAAAATCATGATGGG - Intergenic
1197507176 X:127320562-127320584 TGTAGGTGCAAAATCTTGGTGGG - Intergenic
1198742592 X:139856773-139856795 TGTAGTTAATAAATCACTGTTGG - Intronic
1199278914 X:145976730-145976752 TGTAGTTAATAAATCACTGTTGG - Intergenic