ID: 1096860988

View in Genome Browser
Species Human (GRCh38)
Location 12:54527961-54527983
Sequence TGGAAAAGAGCAGTGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096860978_1096860988 22 Left 1096860978 12:54527916-54527938 CCTGTCTTACCTGACAGAGGGTA 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG 0: 1
1: 0
2: 3
3: 85
4: 423
1096860981_1096860988 13 Left 1096860981 12:54527925-54527947 CCTGACAGAGGGTAAGGGTGAGG 0: 1
1: 0
2: 2
3: 18
4: 262
Right 1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG 0: 1
1: 0
2: 3
3: 85
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096860988 Original CRISPR TGGAAAAGAGCAGTGGTTGA GGG Intronic
900850565 1:5139343-5139365 TGTGAAAGGGCAGTGGGTGAGGG + Intergenic
901329394 1:8393420-8393442 TGACAAAGAGCAGTGGCTTAGGG + Intronic
901760171 1:11465854-11465876 GGGAAATGAGCAGTGGCGGATGG - Intergenic
902702211 1:18180088-18180110 GGGAAAAGAACAGTGGATAAAGG - Intronic
902862752 1:19257806-19257828 GGGAAAAGAGAAGTGGTAGGAGG - Intronic
903529888 1:24022095-24022117 TGGACAAGAACAGAGGTTGTTGG + Intergenic
904961736 1:34338694-34338716 TAGAAAGGGGCAGTGGCTGAAGG - Intergenic
905918861 1:41705582-41705604 TGTAAAAGAGCAGGGGGTGCTGG + Intronic
906091478 1:43183168-43183190 GGGATAAGAGCTGTGATTGAAGG + Intronic
906570500 1:46834084-46834106 AGGAAATGAGGAGTGGTTAATGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908561700 1:65312534-65312556 TGGATAGGATCAGTGGTTTATGG + Intronic
908834712 1:68217486-68217508 TGGAAAACTTCAGTGGTTAACGG + Intronic
909695639 1:78465413-78465435 TGGTGAAGAGCAGTGGGTGAGGG + Intronic
909992975 1:82246247-82246269 TGGAGCAGGGCAGTGGGTGAGGG + Intergenic
910070997 1:83213380-83213402 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912500792 1:110120806-110120828 TGTAAGTGAGCAGGGGTTGAGGG - Intergenic
912517690 1:110226402-110226424 TGGGAAAGAGCAGCGCTAGAGGG + Intronic
915165810 1:153947068-153947090 TGGAATAGAGCAGTGGAGGTGGG + Intergenic
916059918 1:161091424-161091446 TGAAAAAGAGAAGGGGTTGGAGG - Intergenic
916786593 1:168091235-168091257 TGGAGAAGAGCAGTGGCTCCTGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919487855 1:198166357-198166379 TGCAAAAGAGAAGTTCTTGAAGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921277516 1:213534528-213534550 AGCAGAAGAGCAGTGGTTGAAGG - Intergenic
921579546 1:216879787-216879809 TGGAAAAGGGCAGTGGGAGATGG - Intronic
922541487 1:226423647-226423669 TGGGAAATAGCAGTGCTTGGGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923116813 1:230947963-230947985 TAGAATAGGGCAGTGGCTGATGG - Intronic
923538211 1:234869352-234869374 TGGAAGAGAGCAGTGCCTGGAGG - Intergenic
923717847 1:236441068-236441090 TGCAAAAGAGAAGTTTTTGAAGG + Intronic
1063455436 10:6179281-6179303 TGGGGAAGAGCAGTGGATGAGGG + Intronic
1064587072 10:16849871-16849893 TGAAAATAAGGAGTGGTTGAAGG - Intronic
1065434420 10:25692465-25692487 TTGACAAGAGCAATGCTTGAGGG + Intergenic
1065805250 10:29388140-29388162 GGGAAAAAAGCAGTGGTTCCTGG - Intergenic
1068655885 10:59576182-59576204 AGGAAAAGAGCAGTAAGTGATGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069643269 10:69970348-69970370 TGGAGAAAAACTGTGGTTGAAGG - Intergenic
1069899820 10:71701048-71701070 TGGACAAGATCAGTGGTGGTGGG - Intronic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072966294 10:99975581-99975603 TGGAAAAGAGAAGTGGTAAGTGG + Intronic
1073737403 10:106365334-106365356 TTTAAAAGAGCAGTGGTATATGG + Intergenic
1074410693 10:113225855-113225877 TGGAAAGGAGGGGTGGTTGGAGG + Intergenic
1075071366 10:119321903-119321925 AGGAAAAGAACAGGGGTTGGGGG - Intronic
1075438689 10:122462629-122462651 TGGAAAGGAACAGTGTTTGCCGG + Intronic
1075951589 10:126482413-126482435 TGGAAAAGGGCAGGCCTTGAGGG - Intronic
1076025519 10:127108894-127108916 TGGTAAATGGCAGTGGTTCAAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077590523 11:3487402-3487424 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
1077899482 11:6477574-6477596 TGGAAAGGCCCAGGGGTTGAGGG + Intronic
1078420603 11:11209015-11209037 TTGAAAATAGTAGTAGTTGAAGG + Intergenic
1078490403 11:11762838-11762860 TGGAAAAGAGGAGTGTTCTAAGG - Intergenic
1078501395 11:11882134-11882156 GGGCAATGAGCAGTGATTGATGG - Intronic
1078521769 11:12069304-12069326 CGGGACAGAGCAGTGGCTGATGG - Intergenic
1078544713 11:12239002-12239024 AGGAGAAGAGCAGGGGTTGGGGG - Intronic
1078926840 11:15882873-15882895 AGGAAAAGAGCAGAGGTTCCAGG - Intergenic
1079085102 11:17439712-17439734 TGGAAGAGAGCAGCGGAGGAGGG - Intronic
1079388438 11:20000817-20000839 TGCTACAGAGCAGTGGATGAGGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079962165 11:26938046-26938068 AGGAAAAGAAAAGTGGTTGAAGG - Intergenic
1080647117 11:34195316-34195338 TGGAAAAGTGTTGTGGTTGAAGG - Intronic
1081446921 11:43139694-43139716 AGGAAAACCGCAGTGGTTTAAGG - Intergenic
1083139440 11:60709999-60710021 TGGAGAAGAGCAGGTGTTTAGGG - Intronic
1084826433 11:71735317-71735339 TGGAAATGAGTAGTCTTTGAGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085281412 11:75333512-75333534 TGTAAAAGAGAAGTTGATGAGGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086368759 11:86135174-86135196 TGGAAAAGAGAAGGGAATGAGGG + Intergenic
1087758903 11:102084858-102084880 TGGAAGAGAACAGCAGTTGAAGG + Intergenic
1088743497 11:112785678-112785700 TTGAAAAGAGCATTATTTGAAGG + Intergenic
1088868809 11:113874612-113874634 TGAAAAAGTGCAGTACTTGAGGG + Intronic
1089630395 11:119780596-119780618 TGGACTGGAGCAGTGGCTGATGG - Intergenic
1091782205 12:3220927-3220949 TGGAAAAGAGCAACGGATGAAGG - Intronic
1091930038 12:4388769-4388791 CGGAAAAGAGGAGGGGGTGAGGG - Intergenic
1092416811 12:8296308-8296330 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093262488 12:16956310-16956332 TGGAAAAGGGAAGAGGTAGATGG + Intergenic
1093630441 12:21402031-21402053 TGAAAAAGAGCAATGGATTAGGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096440353 12:51637430-51637452 TGCAAAGGAGCAGTTCTTGAAGG + Intronic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097269269 12:57764417-57764439 TGGGACAGAACAGTGGCTGAGGG + Exonic
1097616448 12:61889883-61889905 TAGAAAAAGTCAGTGGTTGATGG - Intronic
1097884071 12:64711542-64711564 TGGGAAAGAGAAGTGGGTGCTGG - Intergenic
1098554358 12:71802013-71802035 TGGAAAAGAACAAAGGTGGAGGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099563854 12:84215438-84215460 TGGAAAAGATTAGTGCATGAAGG + Intergenic
1100271219 12:93026967-93026989 TGGAAAAGTGGAGTGATTTAAGG - Intergenic
1101246976 12:102892753-102892775 GCAAAAAGAGCAGTGGTTGCTGG + Intronic
1105508023 13:21027470-21027492 AGGAAAAGGGCGGAGGTTGAGGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108923569 13:55707932-55707954 TGGAGGAGAGAAATGGTTGACGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109852329 13:68082652-68082674 TGGCAGAGATCAGTGGTTGTGGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111001526 13:82190166-82190188 TGGAAAAGATCTGTGTTTTAAGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111297545 13:86302225-86302247 TTGAATAGGGCAGTGGTAGAGGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112740521 13:102467847-102467869 AGGAAGAGAGCAGAGGTTGATGG + Intergenic
1113221720 13:108112014-108112036 TGGAAAAGGTCAGTGTTTGTCGG + Intergenic
1113870843 13:113559055-113559077 TGGAACAGAGTAGAGGGTGAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114749084 14:25183348-25183370 TGGAACAGAGCAGAGAATGATGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115760398 14:36575230-36575252 TGGAAAAAATCTGGGGTTGAAGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117761240 14:59031079-59031101 TGGAAAAGAGCTGGGGTTAGCGG + Intergenic
1118666500 14:68075758-68075780 TGGTAAAGAGGAGGGGGTGAGGG + Intronic
1118948578 14:70412688-70412710 TGGAAAAGATGATGGGTTGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119960593 14:78851507-78851529 AAGAAAAGACCTGTGGTTGAAGG - Intronic
1121319896 14:92986154-92986176 TGGAGAAGAGCAGTTTTTGTAGG + Intronic
1121734555 14:96208911-96208933 TGGAAATGAGCAGTGCCTGAGGG + Intronic
1122323199 14:100867720-100867742 TGGAGAAGAGGAGGGGTTCAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124581399 15:30958313-30958335 TGGAGAGGAGCAGAGGCTGAGGG + Intronic
1124665288 15:31586913-31586935 TGGAGAAGAGCAGTGGTCCTGGG - Intronic
1125182150 15:36888994-36889016 TGGAAGAGAGGAGGGGTGGACGG + Intergenic
1125413491 15:39429001-39429023 TGGAAGACAGCAGTATTTGAAGG - Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127264475 15:57350426-57350448 TGGAAAAGATCAGTTGAAGAAGG - Intergenic
1127641712 15:60922141-60922163 TTAAAAAGATCAGTGGTTGTTGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129365595 15:75052012-75052034 TGGTAAAGGGCAGTGCTAGAAGG - Intronic
1129589578 15:76903756-76903778 AGGAAAAGAGCATTTGTTGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132100808 15:99021672-99021694 AGGAGAAGAGCAGTGGTGGGTGG - Intergenic
1132426195 15:101719489-101719511 TGGAAGAGAGGAATGGTTTATGG - Intronic
1133355895 16:5136487-5136509 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
1133660335 16:7910317-7910339 AGGAGGAGAGCAGTGGGTGAGGG - Intergenic
1133815884 16:9197049-9197071 TGGATAAAAGCAGTGAGTGAGGG + Intergenic
1134756695 16:16673510-16673532 GGGAAAAGGGTAGTGGTTGATGG + Intergenic
1134989373 16:18685653-18685675 GGGAAAAGGGTAGTGGTTGATGG - Intergenic
1135263616 16:21002280-21002302 TTGAAAAGAGCAGGAGTTGTAGG + Intronic
1135461365 16:22646258-22646280 AGGAAAAGAGCATTGGAAGAAGG - Intergenic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1136036483 16:27544433-27544455 TGGAAAAGAGCAGGGGTAGAGGG + Intronic
1137406140 16:48190977-48190999 TAAAAAAGATCAGTGGTTGCTGG + Intronic
1138571777 16:57878889-57878911 CTGAAATGACCAGTGGTTGAAGG - Intergenic
1138948597 16:61882893-61882915 TGGAAAAAAGAAGTAGTTGCAGG + Intronic
1139646775 16:68337370-68337392 TGGGAAAGATAAGTGGTTAAGGG - Intronic
1139743217 16:69053555-69053577 CAGACAAGAGCAGTGGATGAAGG - Intronic
1141378357 16:83552258-83552280 TGGAGAAGAGCATAGTTTGAGGG + Intronic
1141669098 16:85482184-85482206 TGGAGAAGAGCCGTGGGTGATGG + Intergenic
1143250223 17:5518020-5518042 GGGAAAAGAGCAATGTCTGAAGG - Intronic
1143361427 17:6374784-6374806 TTGGAAAGAGTAGTGGGTGATGG + Intergenic
1143556879 17:7667673-7667695 TCCAAGAGAGCAGTGGGTGATGG + Intronic
1144146986 17:12408185-12408207 TGGAACAGAGCAGAGAGTGAGGG - Intergenic
1144273464 17:13642294-13642316 TAGAAAGGAGCAGGGGTGGAAGG + Intergenic
1144306426 17:13972961-13972983 CAGAAAAGGGCAGTGGTTTATGG - Intergenic
1148322604 17:46766662-46766684 TGGAGAAGAGCTCTGGCTGAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151303488 17:73246762-73246784 AGGAAAAAAGTTGTGGTTGAGGG + Intronic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1152009143 17:77700226-77700248 GGGAGAAGAGCAGGGGTGGACGG + Intergenic
1152140560 17:78534118-78534140 GGGTAAAGGGGAGTGGTTGAGGG - Intronic
1152264885 17:79288445-79288467 TGGAAAGGGGCAGTGGTTATCGG - Intronic
1152438176 17:80288720-80288742 TTGAAAGGAGGAGTGGTTGCTGG - Exonic
1152997887 18:425306-425328 TGGAAAAGAGCAAGGGTCGGGGG - Intronic
1153269976 18:3310749-3310771 TGGAAAAGAGGAGTGAGGGAGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154192420 18:12241874-12241896 TGGAAAATAGCAAGTGTTGATGG - Intergenic
1155136649 18:23001560-23001582 TGTAAAAGAGCACTGGCTTAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159037428 18:63291054-63291076 TGGAAAACAGCTGTGGGTGCCGG - Intronic
1159296834 18:66501438-66501460 TGGAAAATAGAAGTGTTTGAAGG + Exonic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159479394 18:68968270-68968292 TGGAAAAAACCAGTGCTTTAAGG - Intronic
1159819847 18:73127402-73127424 TTTAAAAAAGCAATGGTTGAAGG - Intergenic
1161771151 19:6231354-6231376 TGGAAAAGGGCTGTGAGTGAGGG + Intronic
1161902404 19:7129201-7129223 TGGAAATGAGCAGTGATTTGGGG - Intronic
1162000372 19:7741060-7741082 TGGAAAGGAGCAGTGCAGGAGGG + Exonic
1162860229 19:13500995-13501017 GAGAACAGATCAGTGGTTGAAGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165111964 19:33507786-33507808 TGTAACAGAGCAGTGGTGGCGGG - Intronic
1165268585 19:34683198-34683220 TGGAAAAGAGCCCTGGATGATGG + Exonic
1165274838 19:34739569-34739591 TGGAAAAGAGCCCTGGATGATGG + Exonic
1165690248 19:37857317-37857339 TGGAATGGAGCAGTGGTTGATGG - Intergenic
1165978143 19:39694825-39694847 GGGAAAAGAGCTGAGGATGATGG - Intergenic
1166266692 19:41688765-41688787 GGGAAGAGAGCTGTGGTGGAGGG + Intronic
1167099987 19:47398902-47398924 TGGTCGAGGGCAGTGGTTGAGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925554232 2:5111545-5111567 TGAAAAAAAGCAATGGTGGAGGG - Intergenic
925633868 2:5923422-5923444 TGGACAACAGCTGTGGTTGGGGG - Intergenic
925683561 2:6448387-6448409 GGGAAAAGAGAAGTAGTGGAGGG + Intergenic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927291826 2:21412271-21412293 TGGACAAGAGCAAAGGTTCAAGG + Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929821271 2:45275778-45275800 TGGAAAGAAGCAATGGGTGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932595470 2:73090708-73090730 GTGAAAAGATCAGTGGTTGCTGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933654661 2:84877811-84877833 TGGAAAAGTGCAGTTATTGCAGG - Intronic
933890508 2:86764682-86764704 AGGAAAAGAGCAGTGGATCTAGG + Intronic
934816582 2:97332378-97332400 TGGAAAGGGTCAGTGGTGGAGGG + Intergenic
934821114 2:97376106-97376128 TGGAAAGGGTCAGTGGTGGAGGG - Intergenic
936115192 2:109696585-109696607 TGAAAAAGAACAATGGTTGGAGG - Intergenic
936979112 2:118247681-118247703 TGGAAGACAGCATTGGCTGATGG - Intergenic
938593453 2:132762711-132762733 TGGAACTGAGAAGTGGTAGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940303622 2:152202104-152202126 AGCAAAAGATCAGTGGTTGTTGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941523772 2:166581489-166581511 TGGAAAAGCGCAGTATTTGGAGG - Intergenic
942595893 2:177591611-177591633 TGGAAGATAGAAGTGGCTGAGGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942690178 2:178576744-178576766 TGGAAAAGGCCAGTGGATGATGG - Exonic
943345695 2:186734761-186734783 TGGGAAACAGCAGAGGCTGAGGG - Intronic
943960791 2:194260674-194260696 GGGAAATGAGGAGTTGTTGATGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945286905 2:208091939-208091961 AGGAAAAGAGGAGTACTTGAAGG - Intergenic
946168926 2:217882259-217882281 TGGAACAGACCAGGGGTGGAAGG + Intronic
946907557 2:224431018-224431040 TGATGAAGAGCAGTGGGTGATGG - Intergenic
947933362 2:233982946-233982968 TGGAGAAGAGCAGCGGTTCCAGG - Intronic
948054049 2:234998188-234998210 AGGAACAGAGGAGTGGTTTAGGG - Intronic
948175510 2:235939638-235939660 TGGATGAGAGCAGTGTTGGAGGG - Intronic
948526822 2:238575943-238575965 GGGAATAGCGCAGTGGCTGAAGG - Intergenic
1168857428 20:1018575-1018597 TGGAAAAGAGTGGGGGTGGATGG - Intergenic
1171116177 20:22526617-22526639 AGAAAGAGAGCAGTGGGTGAGGG + Intergenic
1171416600 20:24985688-24985710 TGGAATAGAGCTGTGGGTGAAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172936864 20:38626717-38626739 TGGAAAACAGAGGTGGGTGAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1174535747 20:51249891-51249913 TGGGAAAGAGCAGGCCTTGAGGG - Intergenic
1175529242 20:59662775-59662797 TGGAAATGGGGAGTGGGTGAGGG + Intronic
1176962123 21:15170892-15170914 TGGCAAAGAACAGTGTTTAAAGG + Intergenic
1177101867 21:16907928-16907950 TGGAAAGGAGGAGTGGTGGGGGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177505683 21:22015065-22015087 TGGAAAATGGCAGTGGATTATGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178123345 21:29491886-29491908 GGAAAAAGAGCAGTTTTTGAAGG - Intronic
1178878656 21:36431580-36431602 TGGAAAATAGCAGGTTTTGACGG - Intergenic
1179078994 21:38152595-38152617 TGGAACAGGGTAATGGTTGAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180133251 21:45841956-45841978 TGACAAAGGGCAGTGATTGAAGG - Intronic
1181937425 22:26448958-26448980 GGGAAAAGGGCAGTGGGTGTGGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182614154 22:31575124-31575146 TGGCAGAGAGCAGGGGTTCAAGG - Intronic
1182814462 22:33147881-33147903 GGGAACAGATCAGTGGTTGATGG - Intergenic
1183458302 22:37934522-37934544 GGGAAAGGGGCAGTGGCTGAGGG + Intronic
1184322327 22:43752094-43752116 TGGAAAGGAGAAGTGGTTAGAGG - Intronic
1184970369 22:48015777-48015799 TGGAAAAGAGGAGTGCTTCAGGG - Intergenic
949598402 3:5572562-5572584 TGGAAGGGAGCAGTAGTGGATGG + Intergenic
949626442 3:5872044-5872066 TGCAAAAGAAAAGTGCTTGAAGG + Intergenic
950373413 3:12550401-12550423 GGAAAAAGATCAGTGGTTGACGG + Intronic
950736651 3:15014316-15014338 AGGAAAAGAGCAGACATTGAAGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951370364 3:21838596-21838618 TGGAAAAGAGAAGTTCTGGAAGG + Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
954259756 3:49430105-49430127 TGGAAATCAGCAATGGATGAGGG - Intergenic
954614541 3:51962894-51962916 TGGAGATGAGCAGTGGATGCAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955518081 3:59747813-59747835 TGGAAAGGAGTACTGGTTTAGGG + Intergenic
956198183 3:66674758-66674780 TTTAAAAGAGCCGTGGTTAACGG + Intergenic
957060558 3:75477917-75477939 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
959241231 3:103797303-103797325 TAGAACAGATTAGTGGTTGACGG - Intergenic
959923893 3:111900258-111900280 TGCAAAAGAGAAGTTCTTGAAGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960196337 3:114772960-114772982 TGGAAAAGAGGTGTGGTAGAAGG + Intronic
960422263 3:117461680-117461702 TTGGAAAGAGCAGTTGTTAAAGG - Intergenic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961292825 3:125861479-125861501 TGGAAATGAGTAGTCTTTGAGGG - Intergenic
961894364 3:130154909-130154931 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
962473727 3:135737556-135737578 TGGAAAAGAGTTTTGGTTGAAGG + Intergenic
962866192 3:139449607-139449629 TGGATAATGGCAGTGGGTGATGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
964333674 3:155632171-155632193 CTGAAAAGAGCTGTGCTTGATGG + Intronic
965333649 3:167408402-167408424 GGGAAAAGAACAGATGTTGAGGG - Intergenic
965335342 3:167426400-167426422 TGGAAAAGAGGAGTGGGGAAAGG - Intergenic
965642790 3:170848683-170848705 AGGAAAAGAGCAGCTCTTGAAGG - Intronic
965732087 3:171782983-171783005 TGGTAAAGAGCAGGGGATGGGGG + Intronic
966210423 3:177447680-177447702 AGTAAAAGAGAAGTTGTTGATGG + Intergenic
966513479 3:180790773-180790795 TAGAAAAGAGGAGAGTTTGAGGG + Intronic
967264793 3:187680972-187680994 TGGAAAGGAGCAGTGGTCCCGGG - Intergenic
967412122 3:189177595-189177617 TAGAAAAGAGGAGAGGTTTATGG + Intronic
967885097 3:194328369-194328391 CTGAAAAGAGCAGGGGCTGAAGG - Intergenic
968533718 4:1111214-1111236 TTGGAAAGAGCATTTGTTGAAGG - Intronic
968623751 4:1616634-1616656 TGCAAACCAGAAGTGGTTGAGGG + Intergenic
969004453 4:4007988-4008010 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969748413 4:9092160-9092182 TGGAAATGAGTAGTCTTTGAGGG - Intergenic
970746401 4:19301893-19301915 TGGAAAATAGCAGTGTTTACAGG + Intergenic
970808580 4:20064480-20064502 TGGAAAAGAGAAAGGGATGAAGG + Intergenic
972125505 4:35760486-35760508 TGGTGCAGAGCAGTGGGTGAGGG - Intergenic
972171143 4:36346794-36346816 TTGAGAGGAGCAGTGGTTGCAGG - Intergenic
972377970 4:38490759-38490781 TGGAAAAGTGCATTGGCTGGTGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975428493 4:74259057-74259079 TGGAAAAAAGTAGTGGGTCATGG - Intronic
975676248 4:76830766-76830788 AGGAAAGGAGCTGTGGTGGAAGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978166313 4:105612226-105612248 TGGAAAAAAGCTGTAGTTGTTGG + Intronic
978180866 4:105794223-105794245 GTGAAAAGATCAGTGGTTGCCGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980043885 4:127967585-127967607 TGGAAAAGAGCAGTGTCAGAGGG - Intronic
980587948 4:134842989-134843011 TGGAGGAGGGCAGTGGTTGGGGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980822814 4:138038785-138038807 AGGAAGTGAGCAGTGGGTGAGGG + Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982552317 4:156818433-156818455 TGCAAAAGAAAAGTAGTTGAAGG - Intronic
982738069 4:159027143-159027165 ATGAAAAGAACAGTGTTTGATGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983873404 4:172848551-172848573 GGGAAAAGAGAAGTAGTTGCTGG + Intronic
984613251 4:181865567-181865589 TGGCAAAGAGGAGGGGCTGAAGG + Intergenic
984924603 4:184795640-184795662 TGGTAATGAGCAGTGGTGGTTGG - Intronic
984937492 4:184901787-184901809 TGGGACAGAGCAGTGGTTTAGGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986634797 5:9810757-9810779 TGGCAAAGGGCATTGCTTGAGGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987993035 5:25239866-25239888 TGGCCAGGAGCAGTGGTTCACGG - Intergenic
988611999 5:32735629-32735651 TGGGAAATAGCAGTGGATTAGGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989510432 5:42280612-42280634 AGGAAAAGAGCAGGGGCTGTTGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990013446 5:51027850-51027872 GGGAAAAGAGAAGTAATTGAAGG + Intergenic
990834052 5:59995284-59995306 AAGAAAAGAGAAATGGTTGAAGG - Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991980723 5:72227779-72227801 AGGAAAAGTGGAGTGGTTCATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992610533 5:78504707-78504729 TGGAAGTGAGCAATGATTGAGGG - Intronic
993029470 5:82688530-82688552 TGGAAAAGAGTCATGGTTGATGG - Intergenic
993138696 5:84002883-84002905 TAGAGAAGAGCAGGGGTTGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993852543 5:93029035-93029057 TGGAGAATAGCAGAGGTTGCTGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994310750 5:98267706-98267728 AGGAAAAGTGCAGCGGTTGTGGG + Intergenic
994511817 5:100713542-100713564 TAGAAAATGGCAGTGGTTGCAGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
997101722 5:130976843-130976865 TGGGAAAGACCAGAGCTTGAAGG + Intergenic
997822058 5:137075274-137075296 GGGAAAAGAGGAGTGGTTTCTGG - Intronic
998038121 5:138933623-138933645 TAGATAAGAGCAGCCGTTGAGGG + Intronic
998837634 5:146218352-146218374 AGGAAAAGAGAAGTGGTGAAAGG - Intronic
1000753212 5:165123137-165123159 TGATACAGATCAGTGGTTGAAGG + Intergenic
1001020031 5:168174912-168174934 TGGGAGAGAGCAGTGGTAGCTGG + Intronic
1001379140 5:171291427-171291449 TGGAAGTGAGCAGAAGTTGAAGG + Intronic
1001545789 5:172569857-172569879 TGGAAGGGAGCACTGGGTGATGG - Intergenic
1002282053 5:178136815-178136837 TGGAAAGGAGCAGTGGCCCAGGG + Intronic
1002799543 6:508468-508490 TTAAAAAGATCAGTGGTTGTCGG - Intronic
1003435916 6:6087928-6087950 TGGAAAAAAGCATTGTTTCATGG - Intergenic
1003721440 6:8707523-8707545 GGGAAATGATCAGTGGTGGAAGG + Intergenic
1004158998 6:13196886-13196908 TGGAAAAGAGCAGAGGTGATTGG - Intronic
1004523727 6:16386212-16386234 TGGCAAGGAGGAGTGATTGATGG - Intronic
1004972350 6:20924454-20924476 TGCAAAAGAGAAGTTATTGAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005371482 6:25138239-25138261 TCTAAAAGAGCTGTGGTAGAGGG - Intergenic
1005603706 6:27453965-27453987 TGAAAAAGAGCAGAGGCAGAGGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005994948 6:30925439-30925461 GGGAAAAGAGCAGAGCCTGAAGG + Intronic
1006010760 6:31041136-31041158 TGGAATAAAGCAATTGTTGAAGG - Intergenic
1006418290 6:33918304-33918326 TGGAAAAGACCAGGGGATGCTGG - Intergenic
1006591516 6:35161345-35161367 TGGAAAAGAGGAGAGGTGGCTGG + Intergenic
1006817515 6:36862535-36862557 TGGGAAAGAGCTGTAGATGAAGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007050405 6:38822488-38822510 AGGAATAGCGCAGTGGTTCAAGG - Intronic
1007329614 6:41095160-41095182 TGGGAAAGGGTAGGGGTTGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010016962 6:71116375-71116397 TTGAAAAGAGCCATGGTTTACGG + Intergenic
1010186407 6:73148956-73148978 TGTCAAAGAGCAGTGGGTGATGG + Intronic
1010212591 6:73373867-73373889 TGGCAAAGCGCAGTGGCTCAAGG - Intronic
1011649325 6:89491374-89491396 GGGAAAAGGGCAGGGGTTGTGGG - Intronic
1012009981 6:93771491-93771513 TGGAAAAGAGCAGTTTTGGAAGG + Intergenic
1012119429 6:95345501-95345523 TTGAATATAGCAGAGGTTGAAGG - Intergenic
1012234885 6:96801868-96801890 GGGAAGAGAGCAGTGGTAGTTGG + Intronic
1012489302 6:99762950-99762972 TGAAAAAGTTCAGTGGGTGATGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012809072 6:103935236-103935258 GTAAAAAGACCAGTGGTTGACGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014069960 6:117169339-117169361 GGAAAAGGAGCAGTGGTTCAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015532980 6:134239906-134239928 TGGATAAGAGAAATGATTGAAGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018646543 6:165953939-165953961 TTAAAAAGATCAGTGGTTGCCGG - Intronic
1018911747 6:168104961-168104983 GGGAAAAGATCAGTGGTTGCCGG + Intergenic
1019021241 6:168919913-168919935 TTGAGAAGACCAGAGGTTGATGG + Intergenic
1020324586 7:6964486-6964508 TGGAAATGAGTAGTCTTTGAGGG + Intergenic
1020788422 7:12595569-12595591 TGGATAGGGGCAATGGTTGAGGG + Intronic
1021117528 7:16760622-16760644 TGGAGAAGGGCAGTGGTCCATGG + Intronic
1021729464 7:23582344-23582366 TGGAAAAGAGCAGATGCAGAGGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022612330 7:31889266-31889288 TGGAATAGTGAAGTGGTAGAGGG - Intronic
1022811804 7:33876162-33876184 TGAAAATTAGCAGTGGTTCAAGG + Intergenic
1023466978 7:40466729-40466751 CAGAAAAGAGCAGTGGTAGCTGG + Intronic
1023613938 7:41999523-41999545 TGTAAAAGAGGAGTGGATGAGGG - Intronic
1024037998 7:45524900-45524922 TGGAAAAGAAAAGTGGTTTCTGG + Intergenic
1024143048 7:46481217-46481239 TACAAATGAGCAGTGGTTAAGGG - Intergenic
1027288716 7:76678239-76678261 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
1027367674 7:77474936-77474958 TGGACAAGAGAAGTGGTACAAGG - Intergenic
1027714126 7:81648010-81648032 GTGAAAAGAGCAGTGGTTGCAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028242869 7:88442630-88442652 TGGAAAAGAGAAGAGGGTTATGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030066202 7:105661100-105661122 AGGAAATAAGCAGTGGATGAAGG + Intronic
1030079118 7:105762277-105762299 AGGAAAAGAACAGGGATTGAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032100501 7:128972668-128972690 TAAAAAAGATCAGTGGTTGGTGG + Intronic
1032392154 7:131562296-131562318 TGGAGAAGAGAAGAGGCTGAAGG + Intergenic
1032413954 7:131721931-131721953 TGGAAAAGAGAAGTCGTGCAAGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036175336 8:6532489-6532511 TAGAAAAGAACAGTGTTAGAAGG + Intronic
1036567281 8:9948295-9948317 TGGGAAAGAGAAGAGGTTGGTGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039151058 8:34506090-34506112 GGGAAAAGAGTAGTAGCTGAAGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040636310 8:49277696-49277718 TTGAAAGGAGCAGAGGTTTAAGG + Intergenic
1041346082 8:56899544-56899566 TGGAAAAGAGAAGGGAGTGATGG + Intergenic
1041404357 8:57481907-57481929 TGGACAAGAGCAGAGGTTTATGG + Intergenic
1041789424 8:61676369-61676391 TGGAAAAAAGAAGTGGAGGAAGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043022838 8:75026048-75026070 TGCAAAAGAGAACTAGTTGAGGG + Intronic
1043314498 8:78903327-78903349 AGAGAAAGAGCAGAGGTTGAGGG - Intergenic
1043562425 8:81509740-81509762 TGAAAAAGATCAGTGGTTGCCGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044225909 8:89717890-89717912 GGGAAATGAGCAGTCATTGATGG - Intergenic
1044235733 8:89828015-89828037 TGGAAAACATCAGTGGATCATGG + Intergenic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1045187762 8:99856328-99856350 TGAAAGAAAGCAGTGATTGAAGG + Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047087362 8:121533104-121533126 TAGAACAGAGCAGTGATTAAAGG - Intergenic
1048724430 8:137366435-137366457 GAGAAAAGAGGAGAGGTTGAGGG - Intergenic
1049038136 8:140092627-140092649 GGGGAAAGAGAAGTGCTTGAGGG - Intronic
1049370018 8:142259923-142259945 AGGAACAGGGCAGTGGTTCAGGG + Intronic
1052810179 9:33051279-33051301 AGAAAAAGATCAGTGGTTGCCGG + Intronic
1052956721 9:34258170-34258192 TGAAAAAGAGCAGTGTTGGCTGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056786370 9:89595202-89595224 TGGAAAATAGCAGAGATGGATGG + Intergenic
1057117150 9:92536196-92536218 TAGAAAACAGCAGTGGGTGTGGG + Intronic
1058414700 9:104775495-104775517 TAGAAAAGAGAAGTGGTCCAAGG - Intronic
1060462901 9:123875511-123875533 TGGAGAAAAGCAGTGGTGCAGGG + Intronic
1060904043 9:127288455-127288477 TGGAGAGGAGCAGTGGTAGATGG + Intronic
1062302967 9:135885946-135885968 TGGACAAGTGCAGTGTCTGAGGG - Intronic
1186754054 X:12651307-12651329 TGGATGAGAGCAGGGATTGAGGG - Intronic
1187775903 X:22756997-22757019 TTGGAAAGGGCAGTGATTGAGGG + Intergenic
1190577951 X:51860301-51860323 TGGAAAAGAGAACTGGGTGCAGG + Intronic
1190635835 X:52432890-52432912 TGGAGCAGAACAGTGGTTAAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG + Intronic
1196058713 X:111385001-111385023 TGGAAAAGAGCTTTGGTCAAGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197406301 X:126055910-126055932 TGGAAAAGAACAGTGGGGAAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198281789 X:135149881-135149903 TGTACAAGAGCAGTTGTTGTGGG - Intergenic
1198286521 X:135196693-135196715 TGTACAAGAGCAGTTGTTGTGGG - Intergenic
1198289170 X:135222641-135222663 TGTACAAGAGCAGTTGTTGTGGG + Intergenic
1199273149 X:145909392-145909414 TGGAAATGAACAGTGGGTGATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1201152158 Y:11100299-11100321 AGGCCAAGCGCAGTGGTTGATGG + Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic
1201981130 Y:19911448-19911470 TGGGAAAGAGAAGGGGTTGGGGG - Intergenic