ID: 1096862543

View in Genome Browser
Species Human (GRCh38)
Location 12:54540237-54540259
Sequence GGAGACCTGGAGGGAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096862543_1096862547 -6 Left 1096862543 12:54540237-54540259 CCTGGGATTCCCTCCAGGTCTCC 0: 1
1: 0
2: 3
3: 27
4: 290
Right 1096862547 12:54540254-54540276 GTCTCCTTCTTGAAATACACAGG 0: 1
1: 0
2: 1
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096862543 Original CRISPR GGAGACCTGGAGGGAATCCC AGG (reversed) Intronic
900585521 1:3430669-3430691 GGAGGCCTGGGGGCGATCCCGGG - Intronic
900651927 1:3734054-3734076 GGAAGCCTAGAGGGAACCCCAGG + Exonic
900655642 1:3755503-3755525 GGAGACCTGGAGAGGCACCCAGG + Exonic
900906739 1:5564618-5564640 GGAGACAGGGAGGGAACTCCCGG + Intergenic
901248009 1:7748572-7748594 AGAGAACTGTAGGGAATCCAGGG + Intronic
902288779 1:15423324-15423346 GGAGCCCTGGAGGGAACACAGGG - Intronic
902297913 1:15481081-15481103 GGAGACCTGGGGAGAAACACAGG - Exonic
903224072 1:21885111-21885133 GGAAGCCTGGATGGACTCCCGGG + Exonic
903625109 1:24724853-24724875 GGGGGCCTGGGGGGAACCCCTGG + Intergenic
904675913 1:32199220-32199242 GGAGGCCTGGAGGGAAGGGCAGG - Intergenic
905372708 1:37493067-37493089 GGAGACCTGGTGGGCAACACTGG + Exonic
905958979 1:42027501-42027523 GGAGAGGTGGAGGGAATGCAGGG - Intronic
906085690 1:43131583-43131605 GGAGACCTAGAGGACAGCCCAGG + Intergenic
907335816 1:53698709-53698731 GCAGGTCTGGAGGGCATCCCTGG - Intronic
908777025 1:67650129-67650151 GGAGATCTGGGGGTACTCCCAGG + Intergenic
912331229 1:108821872-108821894 GGAGACCTGGAGGGAGAACGAGG - Intronic
913202234 1:116504250-116504272 GCAGACCTGGATGGAAATCCTGG + Intergenic
913202326 1:116504859-116504881 GCAGACCTGGATGGAAATCCTGG + Intergenic
915265927 1:154717889-154717911 GGTGAACTGGAGGGAGACCCTGG - Intronic
915553442 1:156648017-156648039 GGAGACATGGATGGCTTCCCCGG + Exonic
915946855 1:160159062-160159084 GGAGACCTGGTGGAAATCAAGGG + Exonic
916125724 1:161569216-161569238 GGACACCAGGAGGGGAACCCAGG + Intergenic
916135640 1:161651047-161651069 GGACACCAGGAGGGGAACCCTGG + Intronic
917225332 1:172775607-172775629 GGGGCCCTAGAGGGAATCCTAGG - Intergenic
917711555 1:177690086-177690108 AGAGACCTGGTTTGAATCCCAGG - Intergenic
917747917 1:178028421-178028443 GGAGACCTAGTGAGAATCTCGGG - Intergenic
919439526 1:197613615-197613637 GGAGACCTAGAAGGAATACAGGG - Intronic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
920761838 1:208791496-208791518 GGAGACTCAGAGGGAATCTCTGG + Intergenic
921422016 1:214959084-214959106 GGAGACTTGGAGGGAAGGGCAGG - Intergenic
922526736 1:226309533-226309555 GGAGAACGGGAGGGAGGCCCCGG + Exonic
922570945 1:226634393-226634415 GTAGAGCTGGAGGGGGTCCCTGG - Exonic
922963617 1:229668685-229668707 TGAGGCCTGCAGGGAATACCTGG - Intergenic
924429869 1:243987858-243987880 GGAGACTTAGAGGGATTCCTTGG + Intergenic
924608935 1:245558092-245558114 GGAGGACTGGAGTGACTCCCAGG + Intronic
1062922440 10:1290303-1290325 GGAGGCCTGCAGGGACTCACAGG + Intronic
1063451732 10:6154633-6154655 GGAGACCAGGTGGGAGTCTCTGG + Intronic
1065110618 10:22436802-22436824 GGAGACCCGGAGGCCGTCCCAGG - Intronic
1067726829 10:48776835-48776857 GCAGCCCTTGGGGGAATCCCAGG + Exonic
1069043275 10:63717067-63717089 GGAGAGCTGGAGGAGGTCCCTGG + Intergenic
1070164495 10:73887661-73887683 GCAGCCCTGGAGGGAATGCAGGG - Intergenic
1070731361 10:78830892-78830914 GGAGACATGGAGGGATTCTAAGG - Intergenic
1070760737 10:79022862-79022884 GGAGGCCTGGAGGGAAGCCAGGG + Intergenic
1071519343 10:86319450-86319472 GGAGACCTGGATTGCATTCCTGG - Intronic
1072157946 10:92740986-92741008 GGAGACCTGGAGGCCAACCAGGG - Intergenic
1072801113 10:98393036-98393058 GGGGGCCTGGAGGGAATGCAGGG - Exonic
1073352599 10:102830719-102830741 CCAGGCCTGGAGGGAAGCCCAGG - Exonic
1073798383 10:107013728-107013750 GGAGTCCTGGAGGGAATTTATGG - Intronic
1074405527 10:113177508-113177530 GGAGGCCTGGAGTGGGTCCCAGG + Intergenic
1075115790 10:119626385-119626407 CAAGAGCTGGAGGGCATCCCAGG + Intergenic
1075156658 10:119982842-119982864 GGGGCCCTGGATGGAATCCTAGG + Intergenic
1075798087 10:125135222-125135244 GGACACCTGGAGGCATTCCTGGG - Intronic
1076188060 10:128464228-128464250 AGAGAGCTGGATGGATTCCCTGG - Intergenic
1076819863 10:132932884-132932906 GGCGTCCCGGAGGGAAACCCTGG - Intronic
1077162775 11:1121245-1121267 GGATACCTGGCGGGGAGCCCTGG + Intergenic
1078774687 11:14383254-14383276 AGAGACCAGGAGAGAATCCAAGG - Intergenic
1079492125 11:21000892-21000914 GGAGACCTCCTGGGAATACCGGG - Intronic
1081307709 11:41533981-41534003 GGAGACCTGGAGCTCTTCCCAGG + Intergenic
1081617429 11:44599089-44599111 GGAGAGAGGCAGGGAATCCCTGG + Intronic
1083328603 11:61886305-61886327 AGAGACCGGGAGGGATGCCCAGG + Intronic
1083538682 11:63495500-63495522 GCAGAGCTGGAGGGAGTCCATGG + Intergenic
1083613417 11:64015082-64015104 GGAGACCTGGATGGCAGGCCTGG - Intronic
1083854428 11:65385682-65385704 GGAGACCTTGAGGTTTTCCCAGG - Intergenic
1083942385 11:65903397-65903419 GGAGGCCAGGAGAGAACCCCAGG + Intergenic
1084021708 11:66421645-66421667 GGAGCCGGGGAGGGAAGCCCGGG + Intronic
1084721497 11:70908626-70908648 GGAGGCCTGGTCCGAATCCCAGG - Intronic
1084746700 11:71174978-71175000 GGAGACAAGGAGAGAATTCCAGG - Intronic
1085958341 11:81428622-81428644 TGAGACCTAGATGGAACCCCTGG + Intergenic
1086876074 11:92097097-92097119 GGAGACCTTGAGGGAACCAGGGG + Intergenic
1086887737 11:92224570-92224592 GGCGAACTGGAGGGCATTCCCGG - Intergenic
1088420059 11:109635801-109635823 TGGGACCTGGAGGGAAAGCCTGG + Intergenic
1088806696 11:113359167-113359189 GGAGACTTGGAAGGAGTCTCTGG - Intronic
1089129911 11:116203372-116203394 GGAGCCCTGGAGGGAGATCCAGG - Intergenic
1089324067 11:117645136-117645158 TGAGACCTGCAGGGCTTCCCTGG + Intronic
1089528280 11:119110853-119110875 GTCAACCTGGAGGAAATCCCTGG + Exonic
1090362332 11:126182246-126182268 GGAGGCCTGGAGGGACAGCCTGG - Intergenic
1091412038 12:248309-248331 GGAGAAATGGAGTGAACCCCGGG + Intronic
1091664387 12:2408578-2408600 GTAGACCAGAAGGGAACCCCAGG - Intronic
1094817977 12:34205249-34205271 GGAGGACAGGAGGGGATCCCAGG + Intergenic
1095098932 12:38162011-38162033 GGAGGACAGGAGGGTATCCCAGG - Intergenic
1096743299 12:53710024-53710046 GGAGGGATGGGGGGAATCCCAGG + Intronic
1096862543 12:54540237-54540259 GGAGACCTGGAGGGAATCCCAGG - Intronic
1097052820 12:56233661-56233683 GGAGACCTGCAGGGAATGGATGG + Intronic
1099097423 12:78391971-78391993 GAAGCCATGGAGGGATTCCCAGG + Intergenic
1099596347 12:84671643-84671665 GGAGGCCTGGAGGGCCTACCTGG - Intergenic
1102431418 12:112886724-112886746 GGAGACCTGGATTCAAACCCTGG + Intronic
1102527977 12:113525442-113525464 GGAAACCTGGAGAGGCTCCCTGG + Intergenic
1102547222 12:113665823-113665845 CCAGACCTGGGGGGAATGCCAGG - Intergenic
1102549262 12:113679320-113679342 GGAGACCTGGGTTGAATCCCAGG - Intergenic
1102560957 12:113762069-113762091 GGAGACCTGGAGTGAAAACATGG - Intergenic
1103294788 12:119877092-119877114 GGAGGCCTGGAGGGTCTTCCGGG - Intronic
1103932460 12:124457889-124457911 GGAGGCCTGGAGGGCAGCCCAGG + Intronic
1104585577 12:130045578-130045600 GGAGCCCCGGAGGGCAGCCCAGG - Intergenic
1104821393 12:131679414-131679436 GGAAACGTGGAGGGAATCGGAGG + Intergenic
1105826782 13:24129964-24129986 GAGGACCTGGAGGGACTCCCAGG - Intronic
1106772738 13:32978154-32978176 GGAGTCCTGGAGGGACCACCCGG + Intergenic
1110741930 13:79007893-79007915 GGAGTCCTGGAGGGAAATCAAGG - Intergenic
1111908832 13:94287461-94287483 GGAGACCTAGTAGGAATCCATGG - Intronic
1112489201 13:99847061-99847083 GGAGAACTAGAGGGAGTCACTGG + Intronic
1113254782 13:108495496-108495518 GGAGACCCGGAGGGCTGCCCCGG + Intergenic
1116800519 14:49438916-49438938 GGTGACCTGGAGAGAAGCTCTGG - Intergenic
1117565525 14:56990647-56990669 GGAGACCTGGAAGGAGCCCAAGG + Intergenic
1118705024 14:68472361-68472383 GGAGGCCTAGAGGAAAACCCAGG + Intronic
1118777187 14:68980043-68980065 GGAGACCGGCAGGGAATTCCGGG - Intergenic
1119584472 14:75820130-75820152 GGAGAGCTGGAGTGATTCTCGGG - Exonic
1120381416 14:83784559-83784581 AGAGACCTGAAGGGAACCTCTGG - Intergenic
1121339832 14:93098800-93098822 GGAGTGCTGGAGGGAAGCTCGGG - Intronic
1122055366 14:99094415-99094437 GGTGACCTGCATGGGATCCCAGG + Intergenic
1122634674 14:103124389-103124411 GGAGACCTGGGGCGAGGCCCAGG + Intronic
1122920220 14:104876868-104876890 GGTAACCCGGAGGGAACCCCTGG + Intronic
1123996237 15:25719700-25719722 GGGGACATGGAAGGCATCCCAGG - Intronic
1124070716 15:26390782-26390804 TGTGTCCTGGAGGGAATCCCAGG + Intergenic
1127123078 15:55787746-55787768 AGACACCTGGAGGGTCTCCCAGG + Intergenic
1127288283 15:57549145-57549167 GAAGGCCAGGAGGGAGTCCCTGG - Exonic
1127304502 15:57691458-57691480 GGAGGCCTGGAGTCAGTCCCAGG + Intronic
1128224563 15:65993036-65993058 GGAGACCTGGCAGGAGTTCCGGG - Intronic
1128340796 15:66821369-66821391 GGGGACCTGGAGGGAGGACCTGG - Intergenic
1128352590 15:66901044-66901066 GGAGACCTGGACTGTAGCCCTGG - Intergenic
1128456619 15:67834948-67834970 GGCGCCCTGCCGGGAATCCCAGG + Intergenic
1128462865 15:67884580-67884602 GGGGTTCTGGAGGGAACCCCTGG - Intergenic
1128651027 15:69413895-69413917 ACAGAGCTGGAGGGAAACCCAGG + Intergenic
1128738811 15:70069583-70069605 GGAGACCTCGAGGGAGTTTCTGG - Intronic
1130034107 15:80342095-80342117 GGAGACCTGAAGGGATTCAGGGG - Intergenic
1133097780 16:3458694-3458716 GGAGACCTAGACGGAGCCCCTGG - Intronic
1134861031 16:17560964-17560986 TGAGACCTGGAGTGATCCCCTGG + Intergenic
1135683622 16:24479902-24479924 GGAGTGCTGGAGGTATTCCCAGG + Intergenic
1136111808 16:28068117-28068139 GGTGAGCTGGAGGGGCTCCCAGG - Intergenic
1136484272 16:30561300-30561322 GGTGATCTGGCGGGAATCTCAGG + Intergenic
1136494196 16:30631922-30631944 GGAGACCCAGAGGAAGTCCCTGG + Intergenic
1137422949 16:48351659-48351681 AAAGACCTTGAGGGAATCCCAGG + Exonic
1137696508 16:50465481-50465503 GGAATCCTGGAAGGCATCCCAGG - Intergenic
1137751930 16:50869466-50869488 GGAGACTTCAAGGGAATACCGGG - Intergenic
1139595233 16:67954020-67954042 AGATACCTGGAGGGACTGCCTGG - Intronic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1141208005 16:81948688-81948710 GGAGACCTGGAGGGACACAAAGG + Intronic
1141473086 16:84252625-84252647 GGAGGCCTGGAGGGAAACCCGGG + Intergenic
1142130913 16:88431066-88431088 GGGGACCTGCAGGGGATCCTTGG - Exonic
1142571549 17:878219-878241 GAAGAAGCGGAGGGAATCCCAGG + Intronic
1143671238 17:8397490-8397512 GGGCTCCAGGAGGGAATCCCAGG - Intronic
1144520271 17:15948261-15948283 GGGGAGCCGGAGGGAATGCCAGG + Intronic
1146393691 17:32444797-32444819 GGAGGGCTTGAGGCAATCCCCGG + Intronic
1146548626 17:33761370-33761392 GGAGCTCTGTAGGGAATCCGGGG + Intronic
1147262824 17:39218462-39218484 GGAGACCTGCAGCTACTCCCTGG - Intronic
1148236135 17:45970484-45970506 GCAGAACTGAAGGGAAGCCCAGG + Intronic
1151266203 17:72957374-72957396 GGAGAGCTGCAGGGAATTCCTGG - Intronic
1151273646 17:73016276-73016298 GGAGAACTGGAGTGGAACCCAGG - Intronic
1151335127 17:73435236-73435258 AGAGCCCTGGAGGAAATCTCTGG - Intronic
1152128140 17:78459737-78459759 GGAGAATCGGAGGGAAGCCCCGG + Intronic
1152606974 17:81296256-81296278 GGAGAACAGGAGGAAATGCCTGG + Intergenic
1153474329 18:5481513-5481535 GGTCTCCTGCAGGGAATCCCAGG - Intronic
1160298433 18:77658041-77658063 GGAGATGAGGAGGGAATCGCCGG - Intergenic
1160498529 18:79389541-79389563 GGTGCCCTGGAGGGCGTCCCTGG - Intergenic
1160938728 19:1610136-1610158 GGAGACCTGGAGAGAGGCCTGGG + Exonic
1160974696 19:1787065-1787087 AGAGACCTGGAAGGAAGACCCGG + Intronic
1161258368 19:3322154-3322176 GGAGACCTTGAGGAAAGTCCTGG + Intergenic
1161492853 19:4571797-4571819 GGAAGGCTGGAGGGAGTCCCTGG + Intergenic
1162328711 19:10013706-10013728 TGATTCCTGGAGGGAATCCTGGG - Intronic
1162366480 19:10252534-10252556 GGAGACCTGGAGCGATTGCGGGG - Exonic
1162770903 19:12948839-12948861 GGAGGCCTTGAGGGAGTACCCGG + Intronic
1163695229 19:18760486-18760508 GGAGTCCAGGAGGGAAGCCCTGG + Intronic
1163849177 19:19653889-19653911 GGAGAACTGCAGGGAATGCAGGG + Exonic
1164500493 19:28815425-28815447 TGAGACATGGAGGGATCCCCTGG + Intergenic
1165067481 19:33237435-33237457 GGAGCGCTGGAGGGAGCCCCAGG - Intergenic
1165394855 19:35558544-35558566 GGGGGCCTCCAGGGAATCCCGGG - Intronic
1165739177 19:38195505-38195527 GGAGACGTGGAGGGAAGCCTGGG - Intronic
1165745730 19:38228844-38228866 GGAGAAAGGGAGGGAATCCCCGG + Intronic
1165940542 19:39412936-39412958 GGAGCCCTGGAGGGAGTCTGCGG - Exonic
1166306928 19:41940458-41940480 GGGGACGTGGGGGGGATCCCGGG + Intergenic
1166671330 19:44711124-44711146 AGAGACATGCGGGGAATCCCAGG - Intergenic
1166769041 19:45269535-45269557 GGAGACCTGGGAGGAAGCCAGGG + Intronic
1167039272 19:47013069-47013091 GGAGCCCTGGAGCGAATGCTGGG - Intergenic
1167268007 19:48493087-48493109 GGAGGCCTGGAGAAAATCCAAGG - Intronic
1168694255 19:58396002-58396024 TGAGACCAGCAGGGAATCCAGGG - Intergenic
925099334 2:1232011-1232033 GGAGGCCTTCAGGGAGTCCCTGG + Intronic
925506918 2:4576431-4576453 GGATACCTGGAGGTTAACCCAGG + Intergenic
926315223 2:11704762-11704784 AGAGCCCTGCAGGGGATCCCGGG - Intronic
926712369 2:15891609-15891631 GGAGACCTGCAGGGTGGCCCTGG + Intergenic
927845954 2:26473065-26473087 GGAGACCTGGAGCCCTTCCCTGG + Intronic
928274868 2:29891352-29891374 GGAGACCTAGAGAGGATGCCGGG + Intronic
928448189 2:31351558-31351580 AGAGAGGTGAAGGGAATCCCTGG - Intronic
928891814 2:36213105-36213127 GGACACCTGGAAGGATACCCTGG + Intergenic
929189234 2:39124086-39124108 GGAGACCTACAGGGAGTGCCAGG + Intronic
929779361 2:44947869-44947891 GCAGACCTGGATGGAAACACAGG - Intergenic
930140945 2:47950702-47950724 GTAGCCCTGGAGAGAATGCCTGG + Intergenic
931228403 2:60353214-60353236 CCAGAGCTGGAGGGAGTCCCTGG - Intergenic
932559508 2:72855013-72855035 GGAGCCCTGCAGGAAAGCCCAGG + Intergenic
932579695 2:72985286-72985308 GGAGACCTGCAGTGAACCCCGGG + Intronic
934923951 2:98368288-98368310 TGAGTCCTGGAGTGAGTCCCTGG + Intronic
935058998 2:99592203-99592225 GGAGAGCTGGGGGGCATCTCTGG - Intronic
935733753 2:106089582-106089604 GGAGGCCTGGAGGGAAACCTGGG - Intergenic
936959431 2:118057752-118057774 GAAGACCTGGAGTGAATCATGGG + Intergenic
937427828 2:121814603-121814625 GGAGAACTGGAGAGAGGCCCCGG - Intergenic
937476320 2:122218497-122218519 GCAGACCTGGAGTGAACCCCAGG + Intergenic
938149965 2:128874310-128874332 GGAGACCGTGACAGAATCCCAGG - Intergenic
938264108 2:129913994-129914016 GGCAAACTGGAGGGAATCCCAGG - Intergenic
942158774 2:173159889-173159911 AGATCCCTGGAGGGAAGCCCAGG + Intronic
944391479 2:199224261-199224283 GAAGAGATGGAGGGCATCCCTGG - Intergenic
948298772 2:236886143-236886165 GGAGTCATGGAGGAAAGCCCAGG + Intergenic
948329150 2:237151351-237151373 GGAGACCTGGCTGGACTCCTAGG + Intergenic
948558388 2:238834052-238834074 GGAAGCCTGGAGGGAAAGCCTGG + Intergenic
1172300148 20:33844063-33844085 GGAGTCCTGGGGGGATACCCCGG + Intronic
1175676234 20:60948979-60949001 AGAGACCTTGGTGGAATCCCGGG + Intergenic
1176179272 20:63741879-63741901 GGAGCCCTGGAAGGAGGCCCTGG + Exonic
1176258984 20:64169110-64169132 GGAGACATGGAGGGTCCCCCAGG - Intronic
1176868566 21:14070421-14070443 GGAGGACAGGAGGGTATCCCAGG + Intergenic
1180154199 21:45970355-45970377 GGAGACCTGGAGAAACGCCCAGG + Intergenic
1180185223 21:46135904-46135926 GGAGACTGGGAGGGAATGCTGGG - Intergenic
1181033877 22:20160804-20160826 GGAGACCTGGAGGTTACCCCAGG - Intergenic
1181164067 22:20974125-20974147 GGGGACCTGGAGGACTTCCCTGG + Exonic
1181509477 22:23382599-23382621 GGAGACCTGGAGGTTACCCCAGG + Intergenic
1181556201 22:23673078-23673100 GCAGACCTGTAGGTAAGCCCAGG + Intergenic
1182062302 22:27406909-27406931 AGAGACCTGGAGACCATCCCAGG - Intergenic
1182490413 22:30667960-30667982 GCAGACCTGGAGTTAGTCCCTGG - Intronic
1182583363 22:31328494-31328516 GGAGCCCTGCAGGGATGCCCCGG - Intronic
1183540720 22:38427858-38427880 GGTGACCTGGAGGCCAGCCCAGG - Exonic
1184314532 22:43674474-43674496 GAGGAACTGGAAGGAATCCCAGG + Intronic
1185111480 22:48902495-48902517 GGAGAGCTGGGGTGAATGCCAGG + Intergenic
949135108 3:554992-555014 GGAGACATGGAGGAAAAGCCAGG - Intergenic
949626693 3:5875251-5875273 GTAGACCTGGAGTGGAGCCCAGG + Intergenic
950509794 3:13419537-13419559 GGAGTTTTGGAGGGAAGCCCAGG - Intronic
950861079 3:16148191-16148213 GTAGGACTGGAGGAAATCCCTGG - Intergenic
952792861 3:37214218-37214240 GGAAACCTGTAGGGAAGCCAGGG + Intergenic
953796056 3:45986758-45986780 GGTGACCTGGAGAGACACCCAGG - Intronic
955363389 3:58292179-58292201 AGAGTCCTGCAGGGCATCCCTGG - Intronic
955408796 3:58642706-58642728 GGAGACCACAAGGGAATCCATGG - Intronic
956695941 3:71919574-71919596 AGAGAGCTGGAGAGAATGCCAGG + Intergenic
957189231 3:76984629-76984651 GGAAACGTGGTGGGAAGCCCTGG + Intronic
960159173 3:114331253-114331275 GGAGACCTGGGGAGACGCCCTGG + Intergenic
964469420 3:157036654-157036676 AGAGGGATGGAGGGAATCCCAGG + Intronic
965503986 3:169491321-169491343 TGAGACCTGGAGGAAACTCCAGG - Intronic
965679073 3:171231681-171231703 GCAGACTTGGAGGGAATGGCAGG + Intronic
966402659 3:179563197-179563219 GGAGACCGGAAGGGAACGCCGGG - Intronic
966943950 3:184764544-184764566 GGAGATGTTGGGGGAATCCCAGG - Intergenic
967159652 3:186724296-186724318 GCACACCTGGAGGGACCCCCTGG - Intronic
967983387 3:195078572-195078594 GGAGGCTTGGAGGGCATCACTGG - Intronic
969410659 4:7025825-7025847 GGATGCCTGGAGGGAAACCAAGG - Intronic
970219500 4:13796349-13796371 GGAGATCTGCAGAGGATCCCTGG + Intergenic
970384652 4:15543991-15544013 GAATCCCTGCAGGGAATCCCTGG - Intronic
971336423 4:25727772-25727794 GGACACCTGGGGTGCATCCCAGG + Intergenic
972091616 4:35293282-35293304 GGAGAGCTGGAGAAAATCCCAGG + Intergenic
975562817 4:75723729-75723751 TGAGACCTGTGGGGAATCCAAGG + Intronic
976852432 4:89562853-89562875 GGAGACCTGGAGTGAAGCCCTGG - Intergenic
979163892 4:117500704-117500726 GTAAAGCTGGAGGGAATTCCAGG + Intergenic
980801410 4:137755454-137755476 AGACACCTTGAGGGAATCCCTGG + Intergenic
981012436 4:139939417-139939439 AGAGACATGGTGGGAATCCAAGG - Intronic
982092334 4:151891491-151891513 GGACACCTGGAGGGTTTTCCAGG - Intergenic
982281497 4:153687944-153687966 GGAGACCTATAGTGACTCCCAGG + Intergenic
983866934 4:172778815-172778837 TGAGACCTGGAGGAAGTTCCAGG - Intronic
984412003 4:179407197-179407219 GGAGAAATGGAGTGAATGCCAGG - Intergenic
985478086 5:91114-91136 GGAGGCCTCGAGGGGATCCCAGG + Intergenic
986720348 5:10556657-10556679 GGACAGCTGAAGGGAATCCAGGG + Intergenic
991356612 5:65775493-65775515 GGGGACTTGGGAGGAATCCCTGG - Intronic
992004154 5:72461291-72461313 GGAGACCTAGATGGGTTCCCCGG - Exonic
992350976 5:75928871-75928893 GGAGAACTGGAGGAAATGCCTGG + Intergenic
995527604 5:113063040-113063062 GGAAACCTGGATGGGAACCCGGG - Intronic
996689865 5:126328964-126328986 CGAGTGCTGGAGGTAATCCCAGG - Intergenic
999525024 5:152395492-152395514 GGAGGAGTGGAGTGAATCCCTGG - Exonic
999715479 5:154356684-154356706 GGAGCCCTGGAGTGCAGCCCAGG - Intronic
1001110422 5:168891505-168891527 AGAAAACTGTAGGGAATCCCTGG - Intronic
1002455738 5:179344761-179344783 GGCGCCCCGCAGGGAATCCCCGG - Intronic
1002636836 5:180612826-180612848 GGACACCAGGAGGGAAGGCCGGG - Intronic
1002904512 6:1438002-1438024 GGAGACCCGAAGGGCAGCCCCGG - Intergenic
1003095533 6:3140224-3140246 TTAGAGCTGGAAGGAATCCCAGG + Intronic
1003148539 6:3529276-3529298 GGAGACTTGGAGGGAAGCAGAGG - Intergenic
1003342475 6:5235011-5235033 AGAGACCTGCAGTGAGTCCCCGG - Intronic
1006502417 6:34466956-34466978 GGAGACATGGTGGCAAACCCGGG + Intronic
1007825796 6:44599808-44599830 AGAGACCTGGAGGGAAAGTCAGG + Intergenic
1008543838 6:52568514-52568536 GGAGTCCTGCAGGAAATCACAGG - Intronic
1013454481 6:110317830-110317852 GTAGATCTGGAGGGAGGCCCAGG - Intronic
1014667976 6:124262867-124262889 GGAGACCAGAAGGCAAACCCAGG - Intronic
1014736239 6:125098882-125098904 GGAGACCCAGTTGGAATCCCTGG - Intergenic
1016054453 6:139565178-139565200 TAAGACCTGGAAGGATTCCCTGG + Intergenic
1019616643 7:1965949-1965971 GGAGAGTTGGGGGGCATCCCTGG + Intronic
1019740098 7:2668449-2668471 GGTGAGCTGGAAGGAAGCCCAGG + Intergenic
1019901028 7:4020732-4020754 TGAGGCCTGGATGGACTCCCAGG - Intronic
1022815094 7:33905591-33905613 CGTCACCTGGAGGGAATCCCTGG - Exonic
1024750718 7:52462129-52462151 TGAAACCAGGAGGGAATGCCTGG - Intergenic
1026360299 7:69597568-69597590 GAAGACGAGGCGGGAATCCCAGG + Intergenic
1027267908 7:76504202-76504224 GGAGAAGTGGAGGGAAACCAGGG - Intronic
1027319719 7:77004064-77004086 GGAGAAGTGGAGGGAAACCAGGG - Intergenic
1028170645 7:87591422-87591444 GCAGAGCTGGAAGGAATCACAGG + Intronic
1029422251 7:100477698-100477720 GGACTCCTGGAGGGAATTCGAGG - Exonic
1029607035 7:101605501-101605523 GCAGACCTGGATGCAAACCCAGG + Intergenic
1031450691 7:121914458-121914480 GGAGACCTGGAGAGAATGAAAGG + Intronic
1034075933 7:148231296-148231318 AGAGACCTGCAGAGAATCCAGGG + Intronic
1034966130 7:155392324-155392346 TGATACCTGGAAGGAATCCCTGG + Intronic
1035224950 7:157427898-157427920 GGAGGCCTGGGGGGACCCCCGGG + Intergenic
1035750973 8:1996045-1996067 AGAAACCTGTAGGGAATCTCAGG - Intronic
1036185930 8:6622349-6622371 GGAGACTTGCAGGTGATCCCCGG + Intronic
1038581243 8:28751050-28751072 GGAGCCCTGGGCGGAGTCCCCGG + Exonic
1038720040 8:30027407-30027429 GGAGAAAGGGAGGGAATCCCGGG + Intergenic
1039823043 8:41150640-41150662 GGAGACCTGGAAGGGATCTCTGG + Intergenic
1039942987 8:42107254-42107276 GGAGAACAGGAGCAAATCCCCGG + Intergenic
1040302973 8:46197507-46197529 GGAGACATGCAGGGAATGCTGGG + Intergenic
1045427085 8:102077864-102077886 GGAGGCCTGGAGCTAATCTCTGG - Intronic
1048866027 8:138762438-138762460 CGAGGCCTGGATGGATTCCCTGG - Exonic
1049329711 8:142043700-142043722 GGAGACCTGCAGATAAGCCCTGG + Intergenic
1049721364 8:144116961-144116983 GCAGCTCTGGGGGGAATCCCCGG + Exonic
1050430246 9:5554765-5554787 GGAGACCTGGAGGTGATTCCAGG + Intronic
1053282195 9:36827701-36827723 GAAGAACTGAAGGGAGTCCCAGG - Intergenic
1054781899 9:69173845-69173867 GGAGACCTGGAGTGAGCTCCGGG - Intronic
1056132077 9:83597023-83597045 AGAGACCTGGGGGGATTCTCAGG + Intergenic
1057903018 9:98964176-98964198 GGTGACCTCGGGGGAACCCCAGG - Intronic
1060150040 9:121282596-121282618 GCAGACCTTTTGGGAATCCCTGG - Intronic
1060400328 9:123344836-123344858 GCAGACCTGGACTGAAACCCAGG - Intergenic
1061013672 9:127969819-127969841 GGAAGCCTGGAGGAGATCCCTGG - Intronic
1061172740 9:128970249-128970271 TTAGACCTGGAGGAAATCTCAGG + Intronic
1061183494 9:129038394-129038416 GGAGACCTTGAAGGCATCCTTGG + Intronic
1061577074 9:131513956-131513978 GGAGAGCTGGAGGTGAGCCCCGG - Intronic
1061842880 9:133369910-133369932 GGAGCCGTGGTGGGACTCCCAGG + Intronic
1062119356 9:134825825-134825847 GTAAACCTTGAAGGAATCCCTGG - Exonic
1062456274 9:136640707-136640729 GAAGACCTGGATGGGACCCCTGG - Intergenic
1185446020 X:258389-258411 GGAGCCCTTGAGGGACTCCCAGG + Intergenic
1192195534 X:69025331-69025353 GCCGTCCTGGAGGGACTCCCGGG + Intergenic
1192801050 X:74465348-74465370 GGACACCTGCAGGAACTCCCAGG - Intronic
1194021051 X:88692878-88692900 GGAGACAGGGAGGGGATGCCCGG + Intergenic
1197706858 X:129640268-129640290 GCAGCCCTGGAGGGAATGCTTGG + Intergenic
1198216227 X:134557077-134557099 GGAGAGAGGGAGGGAATACCTGG - Intergenic
1198493975 X:137171842-137171864 GGAGACCTGGAGTGGATCCCTGG + Intergenic
1198533048 X:137563884-137563906 GGGTACCTGGCGGGACTCCCCGG + Intergenic
1201065406 Y:10090944-10090966 GGAGGACCGGAGGGGATCCCAGG - Intergenic