ID: 1096863114

View in Genome Browser
Species Human (GRCh38)
Location 12:54544323-54544345
Sequence ATGCAGATGCAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 512}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096863114_1096863119 18 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863119 12:54544364-54544386 ACAGCAAGACAAGTTGCTGCAGG 0: 1
1: 0
2: 2
3: 15
4: 168
1096863114_1096863124 28 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863124 12:54544374-54544396 AAGTTGCTGCAGGGGGATGGAGG 0: 1
1: 0
2: 0
3: 28
4: 440
1096863114_1096863120 19 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863120 12:54544365-54544387 CAGCAAGACAAGTTGCTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1096863114_1096863121 20 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863121 12:54544366-54544388 AGCAAGACAAGTTGCTGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
1096863114_1096863125 29 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863125 12:54544375-54544397 AGTTGCTGCAGGGGGATGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 422
1096863114_1096863118 -5 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863118 12:54544341-54544363 TGCATATAGAACTGCTTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
1096863114_1096863123 25 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863123 12:54544371-54544393 GACAAGTTGCTGCAGGGGGATGG 0: 1
1: 0
2: 0
3: 21
4: 253
1096863114_1096863122 21 Left 1096863114 12:54544323-54544345 CCCTCCTCCATCTGCATCTGCAT 0: 1
1: 0
2: 6
3: 65
4: 512
Right 1096863122 12:54544367-54544389 GCAAGACAAGTTGCTGCAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096863114 Original CRISPR ATGCAGATGCAGATGGAGGA GGG (reversed) Exonic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902729148 1:18357278-18357300 ATGGAGATGAAGATGGAGTGGGG + Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903468856 1:23570900-23570922 TTGCAGAAGTAGATGGAGGTGGG + Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904883322 1:33716996-33717018 AGGAAGAGGCAGGTGGAGGATGG + Intronic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
908444383 1:64187737-64187759 TTGCAGCTGCTGATGGAGGGAGG - Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
910035351 1:82781891-82781913 AGCCAGATGCAAATGGAGGTGGG - Intergenic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910650116 1:89557578-89557600 ATGCAGATGATGGTGGAGGCAGG + Intronic
911332763 1:96544074-96544096 ATTCAAATGGAGATGGAGAATGG + Intergenic
912240610 1:107903961-107903983 ATCCAGCTGCAGATCGATGAGGG - Intronic
912779110 1:112527389-112527411 ATGCAGAGGCAGTTGGGGGTGGG - Intronic
913305338 1:117424692-117424714 AGGCTGAGGCAGATGGAGGATGG - Intronic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
916352118 1:163862468-163862490 ATGCAGTGGCAGAGGGAGAAGGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916518359 1:165541187-165541209 ATGCAGCTTCAGATGCAGCATGG - Intergenic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916562129 1:165942054-165942076 AGGAAAATGCAGACGGAGGAAGG - Intergenic
917535371 1:175870737-175870759 GTCCAGATGCAGCTGGAGCAAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920048657 1:203150223-203150245 ATACAGATGCAGTGGGAGGTGGG - Intronic
920246679 1:204593061-204593083 ATGCAGATGTTGACTGAGGATGG + Intergenic
920341273 1:205276526-205276548 CTCCAGATGCAGATGGAAGGAGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920642172 1:207763190-207763212 ATGCAATTGCAGCTGGAGGTGGG - Intronic
921119547 1:212124926-212124948 ATCTAGATGCAGATGGAGTCAGG - Intergenic
923144507 1:231188457-231188479 ATAAAGATGCAGCTGGAAGATGG + Intronic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1066200954 10:33142330-33142352 AGGGAGCTGCTGATGGAGGAGGG + Intergenic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067540807 10:47150938-47150960 AACCAGATGCAGATGCAGGGTGG + Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070746185 10:78935481-78935503 ATGAAGCTGCAGCTGGGGGAAGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072768536 10:98116493-98116515 ATCCTGATGGAGGTGGAGGAAGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074536348 10:114330913-114330935 ACCCAGGTGCAGATGGGGGAGGG + Intronic
1074618289 10:115092855-115092877 TTGCAGCTGCAGACGGCGGACGG + Intergenic
1075167016 10:120077747-120077769 ATACACATGCAAATGGAGAACGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076600071 10:131651671-131651693 TTGCTAATGCAGATGAAGGAGGG - Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1078270485 11:9789958-9789980 AGGAGGATGCAGCTGGAGGAAGG + Intronic
1079003223 11:16774754-16774776 ATGCAGATGAGGTTGGAGCAGGG - Intergenic
1079882443 11:25944304-25944326 GTGCAGCTGCAGCTGGAGGGCGG - Intergenic
1080166589 11:29244367-29244389 TTGCAGATGCAGATGGGTCATGG - Intergenic
1080263914 11:30381076-30381098 ATGGAGATGGTGGTGGAGGATGG + Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1081105197 11:39058512-39058534 GTGCAGATTCAGATGGAGGGAGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081874265 11:46397874-46397896 ATCCAGAGGCTGATGGCGGAGGG - Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083151156 11:60792673-60792695 ATGCAAATCCAGCTGGAGGCTGG - Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088810613 11:113389095-113389117 AGGCAGATGTTGAGGGAGGAAGG - Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090943564 11:131409957-131409979 AGGAAGATGCAGGTAGAGGAGGG + Intronic
1091799880 12:3318234-3318256 CTGCAGATGTACTTGGAGGAAGG + Intergenic
1091894229 12:4088049-4088071 ATGCAGAAGCAACTGTAGGAAGG - Intergenic
1092525967 12:9310596-9310618 ATCTAGATGCTTATGGAGGAAGG + Intergenic
1092541324 12:9421211-9421233 ATCTAGATGCTTATGGAGGAAGG - Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1094511724 12:31101284-31101306 ATCTAGATGCTTATGGAGGAAGG + Intronic
1096526206 12:52211831-52211853 ATGCTCCTGCAGAGGGAGGAGGG + Intergenic
1096800246 12:54106115-54106137 ATGTGGATGCAAGTGGAGGAAGG + Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096867402 12:54572963-54572985 TTGCAGGTTCGGATGGAGGAAGG + Intronic
1097306033 12:58069985-58070007 ATACAGAAGGAAATGGAGGAAGG + Intergenic
1097448386 12:59704833-59704855 ATCCACCTCCAGATGGAGGATGG + Exonic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1098042892 12:66370129-66370151 ATGCAGAGGAAGGTAGAGGATGG - Intronic
1098844997 12:75523884-75523906 AAACAGATGGAGCTGGAGGATGG + Intergenic
1098945604 12:76586054-76586076 TTGCAGCTGCATCTGGAGGAGGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101583675 12:106066443-106066465 ATCCAGATGCTTCTGGAGGAGGG - Exonic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102044156 12:109819339-109819361 ATGCACACGCCCATGGAGGAAGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104426584 12:128682975-128682997 AGGCAGACGCACAGGGAGGACGG - Intronic
1104544129 12:129695851-129695873 ATGCAGATTCTGATGGAGGTTGG - Intronic
1104715793 12:131015402-131015424 ATGGAGATGGAGATGGAGACGGG + Intronic
1104715827 12:131015576-131015598 ATGGAGATGGAGATGGAGAGGGG + Intronic
1104792138 12:131489996-131490018 GTGAGGATGCAGTTGGAGGAAGG + Intergenic
1104886408 12:132111819-132111841 AGGGAGATGCAGATGCAGGTGGG + Intronic
1105250791 13:18697479-18697501 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1106080019 13:26492517-26492539 GTGCCGATGCAGATTGAGGGTGG + Intergenic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106743569 13:32674728-32674750 ATGCAGAAGCATATAGAGGTAGG + Intronic
1108379403 13:49841880-49841902 ATGTGGATGCAGATGGAAGCAGG + Intergenic
1108623326 13:52204830-52204852 ATGTAGATGCAGCTGATGGAGGG - Intergenic
1108663399 13:52606207-52606229 ATGTAGATGCAGCTGATGGAGGG + Intergenic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109277548 13:60319411-60319433 AGGCAGCTGCAGATAGAGAAGGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1110761245 13:79232825-79232847 ATGCAGATGGAGATGTTAGATGG - Intergenic
1112136352 13:96582777-96582799 ATGCATATGTAAATAGAGGATGG - Intronic
1112641832 13:101283990-101284012 ATGAAGATGCTGCTGGAGGTTGG - Exonic
1112916996 13:104564068-104564090 ATGCACATCCAGATTGAGGCCGG + Intergenic
1113502867 13:110792261-110792283 ATGCACATGGAGAGAGAGGAAGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115107056 14:29774219-29774241 ATGCACTTGAAGAGGGAGGATGG + Intronic
1115452950 14:33569663-33569685 AGGAACATGCAGATAGAGGATGG + Intronic
1115500075 14:34041813-34041835 ATGTAGAGGCATATGGAGCATGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116021755 14:39469676-39469698 ATGCAGCTGCTGCTGGAGGATGG + Intergenic
1116609489 14:47049283-47049305 ATGGAGATGGAGGTGGGGGAAGG + Intronic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1118953123 14:70452983-70453005 AGGCAGATTCAGATGGTGAAAGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1120410336 14:84145989-84146011 ATGCAGGTGCATTTAGAGGAGGG + Intergenic
1120913329 14:89687802-89687824 AAGTAGATACAGATGGAGGGGGG + Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121346638 14:93141018-93141040 GAGCAGAGGCAAATGGAGGAAGG + Intergenic
1122790891 14:104183745-104183767 ACGCAGCTGCTGATGGTGGATGG + Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123832758 15:24158535-24158557 ATGCAGGTGCTGATGGCTGATGG + Intergenic
1124051434 15:26200474-26200496 ATGCATATGGAAATGGAGGAGGG - Intergenic
1126112507 15:45183996-45184018 TTGCAGATGGAGATAGAGGGAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127616325 15:60689760-60689782 GGCCACATGCAGATGGAGGAGGG + Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1130438496 15:83926549-83926571 TTGCAGATTCACATGGAGGCAGG - Intronic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1134080745 16:11323375-11323397 GTGCAGATGGAGGTGGAGGCTGG + Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135346691 16:21694725-21694747 AAGCAGATGGGGCTGGAGGATGG + Intronic
1135489757 16:22899194-22899216 ATGAGGGTGCAGATGGTGGAGGG + Intronic
1135522403 16:23187540-23187562 GTGCAGATGCAGATGGGGGTTGG - Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138267098 16:55667506-55667528 GTGCTGATGTAGATGGAGGTAGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1138533767 16:57649005-57649027 ATGCAGATGCAGGGGTGGGATGG + Intronic
1139344473 16:66293590-66293612 AAGCAGAGGAAGATGGGGGAGGG + Intergenic
1140665922 16:77227525-77227547 AAGCCCATTCAGATGGAGGAAGG + Intergenic
1141090666 16:81128295-81128317 AGGCACATCCAGATGGATGACGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1144149972 17:12433901-12433923 ATGCGTATGCATATGGAGGAGGG - Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145834324 17:27942659-27942681 ATGCAGATGTCCATGGAGTAAGG + Intergenic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148489909 17:48016391-48016413 AGGCAGCTGTATATGGAGGAAGG - Intergenic
1148686533 17:49504046-49504068 ATGCAGCTGGAGGTGGAGGAGGG - Intronic
1149515283 17:57276539-57276561 ATGCAGAGAAAGATAGAGGAGGG + Intronic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150946459 17:69751522-69751544 ATGCTGTTGCAATTGGAGGAAGG + Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1152930394 17:83106380-83106402 ATTCAGATATAGCTGGAGGATGG + Intergenic
1153372491 18:4334758-4334780 AAACAGATGCAGGTGGAGGCAGG - Intronic
1153778798 18:8476632-8476654 ATGAAGATGCATTTGGGGGAGGG + Intergenic
1153812886 18:8767085-8767107 TGGCAGAGGCTGATGGAGGAGGG + Intronic
1154335947 18:13464868-13464890 ATGCACATGAATATGGAGCACGG - Intronic
1154438059 18:14361447-14361469 CGGCAGATGCAGCTGGAAGATGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1156492854 18:37506541-37506563 AGGCAGATGGAGAGGGAGGTTGG + Intronic
1156997521 18:43485497-43485519 ATGCAACTGCTGATGGAGGGAGG - Intergenic
1157482433 18:48064111-48064133 ATGCATATGCAGCTGCTGGATGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158274375 18:55750697-55750719 ATGAAGATGTAAATGGGGGAAGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159499027 18:69244952-69244974 ATACAGATGCAGATGGACACAGG + Intergenic
1160047404 18:75399894-75399916 ATGCACATGAGGATGGAGCAAGG + Intergenic
1161000649 19:1909182-1909204 GGGCAGATGCAGGTGGGGGAAGG + Intronic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161864912 19:6826694-6826716 GTGCAGATGAAGCTGGAGGTGGG + Exonic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1164712058 19:30363909-30363931 ATGCATTTGCAGATTTAGGAGGG + Intronic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167424677 19:49423882-49423904 AGTCAGATGGAGATGGAGGAGGG + Exonic
1168135650 19:54349481-54349503 ATGCAGATCCTGAGGGTGGACGG + Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
926924888 2:17977268-17977290 ATTCTGTTGCAGAAGGAGGAAGG - Intronic
927114877 2:19889874-19889896 AAGAAGATGCAGGTGGAGTAGGG - Intergenic
928061323 2:28116165-28116187 AGGCTAATGTAGATGGAGGAGGG + Intronic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
928276194 2:29902371-29902393 ATGCAGATTCAGCAGGATGATGG - Intronic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
928913646 2:36448280-36448302 AGGCAGATGCATTTGAAGGATGG + Intronic
928954207 2:36844755-36844777 ATGAAGATCCAGTTGGATGATGG + Exonic
929321585 2:40550265-40550287 ATGCAGATGCTGGTGGGGAAAGG + Intronic
930155855 2:48107026-48107048 ATGCAGATGCCGAGGGGTGAGGG + Intergenic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
932290525 2:70573756-70573778 ATGCAGTTGCAGTTGGATGATGG - Intergenic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932335442 2:70928478-70928500 AGTCAGAGGCAGATGGAGCAGGG - Intronic
932450434 2:71806991-71807013 ATGCGGATGCTGATGAAGGGTGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933638058 2:84728752-84728774 AAGCAGATGAACATGAAGGAGGG - Intronic
933985331 2:87586331-87586353 ATGCATTTGCAGTTGGATGATGG + Intergenic
934539260 2:95160458-95160480 ATTCAGGGGCAGATGGAGAAAGG - Intronic
935827475 2:106965728-106965750 ATGGAGATTCTGCTGGAGGAGGG + Intergenic
936308513 2:111364478-111364500 ATGCATTTGCAGTTGGATGATGG - Intergenic
937791275 2:125964933-125964955 AGGGAAATGCAGATGAAGGAGGG + Intergenic
939097709 2:137853649-137853671 ATGCAGATGAAAGTGCAGGAAGG + Intergenic
939098008 2:137858009-137858031 ACGCAGATGAAAATGCAGGAGGG - Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
940163709 2:150743489-150743511 ATACACATACAGTTGGAGGAGGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940827220 2:158426430-158426452 TTGCATATTCAGATGTAGGAAGG + Intronic
942155628 2:173124444-173124466 CTGCAGCTGCAAATGGATGATGG + Intronic
942394000 2:175526968-175526990 ATGCAGATAAAGATGGGGAAGGG - Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
948063838 2:235062020-235062042 AGGCAGACAGAGATGGAGGAGGG + Intergenic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
948962396 2:241350121-241350143 ATGCAGATGCAGGGCGGGGATGG + Exonic
949027887 2:241774823-241774845 ATGCCAATGCCGATGGAGGCGGG + Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171340775 20:24425925-24425947 ATGCAGATGCAGATGGAAATCGG + Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172401246 20:34653680-34653702 ATGCATATGCTGATAGAGGTAGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1172950524 20:38720489-38720511 AGGGAGATGGAGATGGAAGAGGG - Intergenic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173247037 20:41344096-41344118 ATGCAGATGCTGATTCAGTAGGG + Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175577960 20:60076784-60076806 ATGCAGCTACACAGGGAGGAAGG - Intergenic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176457618 21:6928022-6928044 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176835790 21:13793106-13793128 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1177208857 21:18044959-18044981 ATGCAGATGCATGTGGGTGAGGG + Intronic
1177953956 21:27573798-27573820 ATGGAGATGAAGATGGAGATGGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1179996497 21:44976768-44976790 CGGCAGATGCAGCTGGAAGATGG + Exonic
1181421588 22:22803090-22803112 AGGCAGATGCAGACGGGGGCTGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183445022 22:37847933-37847955 ATGCAGATACCGATGGGGAAGGG + Intronic
1183573163 22:38669449-38669471 ATGCAGAAGTGGATGAAGGAGGG + Intronic
1184034316 22:41911248-41911270 GTCCAGGTGCAGATGGGGGACGG - Exonic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1185099037 22:48827895-48827917 ATGCAGCTTCAGGTGGAGGCGGG + Intronic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949877262 3:8634441-8634463 ATGAAGATGCAAGGGGAGGAAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950321408 3:12058004-12058026 ATGTAGATTCTGATGGAGAAGGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950539852 3:13605321-13605343 ATGCAGATGGAGGTGGTGGATGG - Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952446139 3:33382877-33382899 ATGTAGATGCAGATGGAATTGGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953385513 3:42503612-42503634 AGGCAGATGCTGATTGAGGCAGG + Intronic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
953510966 3:43538724-43538746 ATGCAGAGGGGGATGCAGGATGG + Intronic
954211491 3:49100024-49100046 ATGAAGCTGGTGATGGAGGATGG - Exonic
954408378 3:50358249-50358271 AGGCTGATGGTGATGGAGGATGG + Exonic
956193114 3:66625872-66625894 AAGCAGCTTCAGATGGAAGAAGG - Intergenic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
957663255 3:83188486-83188508 GTGGAGATGCACATGGATGAGGG + Intergenic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960611154 3:119555929-119555951 TTACAGAGGCAGATGGATGATGG - Intronic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961917018 3:130386906-130386928 GAGCAGATGCAGATGGAGTGAGG + Intronic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
966025895 3:175280982-175281004 ATGCAGATTCTAATGGAAGAGGG - Intronic
966790691 3:183666855-183666877 AAGCAGATGGAGATGGGGGCAGG - Intronic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967155955 3:186692416-186692438 ATTCAGAGGCAGATTGAGGGAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
967654954 3:192036177-192036199 ATGCAAATGCATATTGAGGAAGG + Intergenic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969467548 4:7366546-7366568 AGGCTGATGAGGATGGAGGAGGG - Intronic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970090606 4:12403421-12403443 AGGGAGATGGAGATGGAGGGAGG - Intergenic
971262737 4:25071670-25071692 AAGGAGATGAAGTTGGAGGAAGG - Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
972342711 4:38166252-38166274 ATGCAGATGGAAATGAAGCAAGG + Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
975732872 4:77354585-77354607 ATACAGCTGTAGATGGAGGCAGG + Intronic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976894809 4:90096723-90096745 ATGCCCATCCACATGGAGGAGGG + Intergenic
977427800 4:96891227-96891249 ATGCATATGGGCATGGAGGAAGG + Intergenic
978686848 4:111455427-111455449 AAGAAGATGCAGCTGGAAGATGG + Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
978850028 4:113323845-113323867 ATGCAGAAGGAGATGGCGAAAGG - Intronic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
979552338 4:122005090-122005112 ATGAGGATCGAGATGGAGGAGGG - Intergenic
980334432 4:131452324-131452346 ATACATATGCAGATAGAGAAAGG - Intergenic
981612036 4:146603973-146603995 ATGCTGTTGAAGATGGTGGAGGG + Intergenic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
982896886 4:160941541-160941563 ATGGAGATGCGGATGGACCATGG + Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
983548714 4:168992464-168992486 ATGCAGGTGCAGATGCAGTTTGG - Intronic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984811758 4:183801611-183801633 GTGCAGATGGAGATGGGGGTGGG + Intergenic
984959850 4:185086187-185086209 AGGGAGCTGCAGATGGCGGAGGG + Intergenic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
985750682 5:1672536-1672558 AGGCAGATGCAGATGCAAGCTGG - Intergenic
985970873 5:3377478-3377500 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970882 5:3377526-3377548 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970892 5:3377574-3377596 ATGGAGATGAAGATGCAGGGAGG + Intergenic
985970901 5:3377623-3377645 ATGGAGATGGAGATGCAGGGAGG + Intergenic
986710606 5:10485792-10485814 ATGCAGATTCTGATGCAGAAGGG + Intergenic
988425918 5:31064185-31064207 ATGCAGATGCATTTGGAGGTAGG + Intergenic
988427375 5:31079146-31079168 AACCAGAAGCAGATGGAGGGAGG - Intergenic
988681662 5:33489645-33489667 ATGCCGAGGCAGATGGGGGTGGG - Intergenic
988684049 5:33511103-33511125 ATGCAGATACAGATGGTCCAAGG - Intergenic
988996483 5:36719895-36719917 ATTCAGATGCAGCTGGTTGAAGG - Intergenic
990494220 5:56330961-56330983 CTGCAGATTCAGATGTGGGAGGG + Intergenic
990607595 5:57426191-57426213 TAGCAGATGCTGATGGAGGGAGG + Intergenic
991131727 5:63130491-63130513 ACGCAGATGCTGTTGGAGCAGGG - Intergenic
992163790 5:74028454-74028476 ATGTAGATGCAGGTAGAGGCTGG - Intergenic
992620692 5:78589608-78589630 ATGCGGGTGCAGGTTGAGGAGGG - Intronic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
993761563 5:91802411-91802433 ATGCCTAGGCAGATGGGGGAGGG + Intergenic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995588600 5:113674732-113674754 ATGCTGCTGGAGATGGGGGAAGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
998932818 5:147199990-147200012 AGGCAGATTCAGATGGAGAGAGG - Intergenic
999109804 5:149109121-149109143 ATACTGATGCAGATGGGTGATGG - Intergenic
999190318 5:149742286-149742308 GTGCAGGTGCAGATGGGAGAGGG - Intronic
999743049 5:154571467-154571489 ATGCAGATTCTGATTCAGGAAGG + Intergenic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000483986 5:161816134-161816156 AAGCAGATGAAAATGAAGGAAGG - Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001931992 5:175679728-175679750 ATGCAAAGGCAGAGGAAGGAGGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002505997 5:179679476-179679498 ATACATATGCAGATGAAGGACGG + Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1003336162 6:5174976-5174998 ATTCATGTGCAGATGAAGGAAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1003737816 6:8897480-8897502 ATGTATATGCAGTTGGATGATGG + Intergenic
1004288292 6:14343204-14343226 AAGCAGATTCAGAGGGAGCACGG + Intergenic
1004351457 6:14893655-14893677 ATGCAGGTGCAGATAAAGGAAGG - Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1006362526 6:33594791-33594813 AGGCAGATGCAGTGAGAGGATGG - Intergenic
1006364488 6:33607397-33607419 AGGCAGCTGCAGTTGGAGGCTGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1008082231 6:47206541-47206563 AAGCAGTTGAACATGGAGGAAGG + Intergenic
1008583713 6:52929923-52929945 ATGCAGATGCTGATTCAGTAAGG + Intergenic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1012257662 6:97052252-97052274 ATGCACATGCAGATGCAGACTGG + Intronic
1012684322 6:102225407-102225429 ATGTAGATGGAGATCTAGGAGGG + Intergenic
1013780878 6:113727222-113727244 ATGCAAATGCAAATGTGGGAAGG - Intergenic
1014046350 6:116892549-116892571 ATGCAGATGCAGCTGGATCTTGG + Intronic
1014344121 6:120245914-120245936 GTTCAGTTGCAGATGAAGGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1017189958 6:151642551-151642573 ATGAAGATGCAGTTCAAGGAAGG - Intergenic
1017853077 6:158322831-158322853 ATGGAAATGCAAATAGAGGAAGG - Intronic
1017995440 6:159528010-159528032 AATCAGATGCAGATGGAGCCTGG + Intergenic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018633358 6:165839759-165839781 ATGCAGATGGGGATGGAGACAGG - Intronic
1018633409 6:165839999-165840021 ATGCAGATGAGGATGGAGATGGG - Intronic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1022486433 7:30782158-30782180 TTTCAGATGAAGATGCAGGATGG + Exonic
1023668745 7:42554207-42554229 ATGCAAATGGGGGTGGAGGAAGG + Intergenic
1024022595 7:45385666-45385688 AGGCAGAGGGAGATGGAAGACGG + Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026621280 7:71952002-71952024 ATGCGGCTGCTGATGGTGGAGGG + Intronic
1027052447 7:75028732-75028754 CTGGAGATGCCCATGGAGGAAGG - Intronic
1028721663 7:94039913-94039935 ACGCAGATGGAGAAGGAGAAAGG - Intergenic
1031057586 7:117010483-117010505 ATGCTGATGCAGATGCAGGCTGG + Intronic
1031215315 7:118883040-118883062 ATGCAGCCGCAGCTGGGGGATGG - Intergenic
1031300796 7:120059310-120059332 ATGCAGATGCCGATGCAGAAAGG - Intergenic
1031543839 7:123028435-123028457 AGGCCGATGCAGATGGAACATGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1033052657 7:138020590-138020612 ATGGAGCTGAAGTTGGAGGATGG - Intronic
1034187933 7:149193793-149193815 AAGCTGATGAAGATGGAGGAGGG - Intergenic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034731055 7:153387885-153387907 ATGCATATGCTCATGGAGAATGG + Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038411063 8:27360372-27360394 ATGCTGATGCTGATGGGAGACGG + Intronic
1039490766 8:37945840-37945862 ATGCAGATGCAGAGAGAAGTTGG + Intergenic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043411346 8:80000048-80000070 GTGCATATGCAAATGGGGGAAGG - Intronic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045533374 8:103004789-103004811 AAGCAGTTGCAAGTGGAGGATGG + Intergenic
1046247555 8:111584700-111584722 ATGCAGAAGAAGCTGGAGAATGG + Intergenic
1046476723 8:114755075-114755097 CTGCTGATGCAAATGGTGGAAGG + Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047756972 8:127926440-127926462 AAGCAGCTCCAGTTGGAGGAAGG - Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350914 8:142164170-142164192 AGAGAGATGAAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1050826165 9:9949470-9949492 ATCCACATGAAGATGGAGGAAGG - Intronic
1051616977 9:19015864-19015886 ATTCAGATGCAGGTGGGTGATGG - Intronic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054475114 9:65566667-65566689 ATGTGGATGCAGGTGGACGAAGG - Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1057081296 9:92176462-92176484 TGACAGAAGCAGATGGAGGAGGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1060224785 9:121784144-121784166 AGACAGATGCTGGTGGAGGAAGG + Exonic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1060997408 9:127882953-127882975 GTGCAGATGGAGGTGCAGGAAGG + Intergenic
1061946277 9:133909937-133909959 ATGCAGGGGAGGATGGAGGATGG - Intronic
1062160464 9:135076792-135076814 ATTCTGAGGGAGATGGAGGAAGG - Intronic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1186303061 X:8221454-8221476 ATGCAGATAAAGATGGAAGTCGG - Intergenic
1186326315 X:8481155-8481177 ATGCAGATGCTGATTCAGCAGGG + Intergenic
1186815913 X:13238011-13238033 ATGCAGATGGAGGTGGGAGAAGG - Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1190485880 X:50924513-50924535 ATGCAGATGAACCTGGAGGATGG - Intergenic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1195513317 X:105742892-105742914 ATGGTGATGGAGATGGAGAAGGG - Intronic
1196185887 X:112744399-112744421 ATGGCTATGCAGATGGAAGAAGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1198130677 X:133691618-133691640 ATACAGATGAAGATAGAGAAAGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201858844 Y:18573288-18573310 ATACAGATGCAGATGTGGAAGGG - Intronic
1201874478 Y:18747093-18747115 ATACAGATGCAGATGTGGAAGGG + Intronic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic