ID: 1096865250

View in Genome Browser
Species Human (GRCh38)
Location 12:54558726-54558748
Sequence AGATGGCACCTGGATATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096865250_1096865262 19 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865262 12:54558768-54558790 AGGGGTCCTGGCTGTAAGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 171
1096865250_1096865265 27 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865265 12:54558776-54558798 TGGCTGTAAGAGTGGGCATATGG 0: 1
1: 0
2: 4
3: 44
4: 210
1096865250_1096865258 0 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865258 12:54558749-54558771 GAGGCCTGGATGGAAAGTCAGGG 0: 1
1: 0
2: 2
3: 35
4: 310
1096865250_1096865259 1 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865259 12:54558750-54558772 AGGCCTGGATGGAAAGTCAGGGG 0: 1
1: 0
2: 4
3: 21
4: 298
1096865250_1096865261 7 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865261 12:54558756-54558778 GGATGGAAAGTCAGGGGTCCTGG 0: 1
1: 0
2: 2
3: 31
4: 294
1096865250_1096865257 -1 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865257 12:54558748-54558770 TGAGGCCTGGATGGAAAGTCAGG 0: 1
1: 0
2: 3
3: 27
4: 276
1096865250_1096865255 -10 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865255 12:54558739-54558761 GGTGCCATCTGAGGCCTGGATGG 0: 1
1: 0
2: 5
3: 24
4: 323
1096865250_1096865263 20 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865263 12:54558769-54558791 GGGGTCCTGGCTGTAAGAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 174
1096865250_1096865266 28 Left 1096865250 12:54558726-54558748 CCACCAATATCCAGGTGCCATCT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1096865266 12:54558777-54558799 GGCTGTAAGAGTGGGCATATGGG 0: 1
1: 0
2: 0
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096865250 Original CRISPR AGATGGCACCTGGATATTGG TGG (reversed) Intronic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
904096010 1:27977895-27977917 AGTTGGGACCTGTATAGTGGTGG + Intronic
906230063 1:44154719-44154741 AAATGGCCTCTGAATATTGGCGG + Intergenic
909366456 1:74828982-74829004 GGATTGCATCTGGATATTGCAGG + Intergenic
909670412 1:78182274-78182296 AGATGGCATCTGGATATCTGAGG - Intergenic
915861245 1:159446997-159447019 AGTTGCCACCTGGATATCTGAGG + Intergenic
920499041 1:206474755-206474777 AGCTGGGACCTGGAGAATGGGGG + Intronic
922569572 1:226626044-226626066 ACGTGGCACCAGGAGATTGGAGG - Intergenic
1065959934 10:30726077-30726099 ACATGGCACTTGGAAAATGGCGG + Intergenic
1067324576 10:45255283-45255305 AGATAACACCTGGACATTGTGGG + Intergenic
1067509933 10:46886167-46886189 AGATGGGGCCTGGGAATTGGTGG + Intergenic
1067652320 10:48165691-48165713 AGATGGGGCCTGGGAATTGGTGG - Intronic
1072177994 10:92948068-92948090 AGATTGTACCTGGATTTTGAGGG + Intronic
1073712099 10:106055424-106055446 AGATGGTATCTGGATGTTTGAGG + Intergenic
1074778801 10:116785697-116785719 AGAGGGCAGGTGGATATTTGGGG - Intergenic
1077545527 11:3167827-3167849 AAATGCCACCTGGAAACTGGAGG - Intergenic
1077649739 11:3959335-3959357 AGATGGACAGTGGATATTGGTGG + Intronic
1078121632 11:8516599-8516621 AGATGGTACCTGGAAAATCGGGG + Intronic
1079620732 11:22550959-22550981 AGATTGCTCCTGAATAATGGAGG - Intergenic
1079919766 11:26418469-26418491 AAATGGCATTTGGATTTTGGTGG - Intronic
1080082597 11:28238484-28238506 AGATGGCACCTGGAAAATCGGGG - Intronic
1080310264 11:30882086-30882108 ACTTGGCACCTGCATTTTGGGGG - Intronic
1080928776 11:36785472-36785494 AGATGACACCTGGATAAAGCAGG + Intergenic
1081389686 11:42514900-42514922 AGATGGCACCTGGAAAATTGGGG + Intergenic
1083728770 11:64642372-64642394 TGATGGGAGCTGGAGATTGGAGG + Intronic
1085177390 11:74502579-74502601 AGATGCCAGCTGCATTTTGGGGG + Intronic
1085232505 11:74984623-74984645 AGATGGCACAGGAATATCGGGGG - Intergenic
1088674245 11:112176427-112176449 ACATGGCAACTGGATCTTGAAGG + Intronic
1089726846 11:120488617-120488639 AGTTGGCACCTGGAAATGGTGGG - Exonic
1092562692 12:9633144-9633166 AGATGGTACCTGGAAAATCGGGG - Intergenic
1096145184 12:49273949-49273971 TGATGGCACCTGCCTATAGGTGG + Exonic
1096865250 12:54558726-54558748 AGATGGCACCTGGATATTGGTGG - Intronic
1097996077 12:65888969-65888991 AGAAGGCAGCTGATTATTGGTGG - Intronic
1098563173 12:71901011-71901033 ATATGGCATATGGATATTGCTGG + Intronic
1107167581 13:37300231-37300253 AGATGGCTCTTTGATATTGAGGG + Intergenic
1107691792 13:42960881-42960903 ATTGGGCACCTGGATATTGCAGG + Intronic
1108453265 13:50588085-50588107 AGATTGCACCTGGGTGTGGGAGG - Intronic
1115698608 14:35926104-35926126 AGATGGCACCTGGAAAATGATGG - Intronic
1116749520 14:48865812-48865834 ACATTGCTCCTGGATGTTGGAGG - Intergenic
1121879909 14:97490705-97490727 AGGTGGCACATGGCTATCGGAGG + Intergenic
1122983997 14:105203840-105203862 AGAAGGCACCTGGGGGTTGGGGG + Intergenic
1123166513 14:106330460-106330482 ATTGGGCTCCTGGATATTGGAGG - Intergenic
1123169195 14:106355498-106355520 ATTGGGCTCCTGGATATTGGAGG - Intergenic
1127102990 15:55587104-55587126 AAATGCCACCCGGAAATTGGGGG - Intronic
1127461692 15:59204979-59205001 AGATGGCACTTGGAATTTGGGGG + Intronic
1128138185 15:65279576-65279598 AGATGGCATCTGAACAGTGGAGG - Intronic
1129586004 15:76865861-76865883 AGATGACACATGGATATTCAGGG - Intronic
1129790417 15:78337411-78337433 AGGTGGCACATGGAAATGGGAGG - Intergenic
1131555603 15:93395828-93395850 AGATGGCACCTGGAAAATCGGGG - Intergenic
1134512126 16:14856910-14856932 AGATGGCACCGGGGTAAGGGTGG + Intronic
1135492403 16:22920984-22921006 AGATGCCACCTGGGGGTTGGGGG - Intergenic
1137971358 16:52988154-52988176 AGAAGGAAACTGGATCTTGGTGG - Intergenic
1138773034 16:59687621-59687643 AGGAGGCAACTGGATAATGGGGG - Intergenic
1139668548 16:68475367-68475389 TGATCACACCTGGATCTTGGGGG - Intergenic
1140929392 16:79613139-79613161 AGATGACACCAGGATGGTGGAGG - Intergenic
1141129759 16:81428049-81428071 AGATGGGTGCTGGATAATGGAGG - Intergenic
1150131602 17:62672193-62672215 GGGTGGCACCTGGAGGTTGGGGG - Intronic
1150722450 17:67625245-67625267 AGATGGGACCTGGGTGTGGGAGG - Intronic
1157591871 18:48841141-48841163 AGAGGGCACCTGGTTAATGTAGG + Intronic
1158110929 18:53940916-53940938 AGATTGCAACAGGAAATTGGAGG + Intergenic
1158156917 18:54436478-54436500 AGACTGAAGCTGGATATTGGAGG + Intergenic
1159434777 18:68401876-68401898 AGAGAGTACCTGGATCTTGGAGG - Intergenic
1160784307 19:892560-892582 GGATGGACCCTGGAGATTGGGGG - Intronic
1165827484 19:38713595-38713617 ACATGGCACCTGGAGACAGGCGG - Intronic
1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG + Intronic
1166149777 19:40864102-40864124 AGATGTAACATGGCTATTGGAGG + Intronic
1166637312 19:44461709-44461731 AGATGGCACATTGAAATTTGAGG - Intergenic
1167984965 19:53306970-53306992 AGATAGCACCTGGTTATTGAGGG + Intergenic
930111529 2:47682859-47682881 AGATGTCACCTGGGGAGTGGTGG + Intergenic
932473241 2:71978395-71978417 AGATGGTACCTGGAAAATCGGGG - Intergenic
933648481 2:84830847-84830869 AGAGGGCAGCTGGAGATGGGCGG + Intronic
937962233 2:127469125-127469147 AGAAGGCACATGGACATTAGAGG + Intronic
938657200 2:133446758-133446780 AGATGACAGCTGAATAATGGAGG + Intronic
939057917 2:137385108-137385130 AGATGGCACCTGGGTGTCTGTGG - Intronic
940898022 2:159099700-159099722 AGATGTCACCTGGAAGATGGTGG - Intronic
944304345 2:198162324-198162346 AGATGGCACAAGGATAATAGAGG - Intronic
945176027 2:207044306-207044328 GGATGGAAACTGCATATTGGAGG + Intergenic
945806553 2:214497619-214497641 AAATGGCAGCTGGAAATTTGGGG - Intronic
947273860 2:228369795-228369817 AGATGGCACTTGGAGAATGGTGG + Intergenic
1168818955 20:760860-760882 AGATGGCACCTGGAAATGCAAGG - Exonic
1169510528 20:6259168-6259190 AGATGACACCTGTACTTTGGTGG + Intergenic
1169676896 20:8164503-8164525 AAATGGCACCTGGACACAGGTGG - Intronic
1169855182 20:10094246-10094268 AGATGGATCCTGGATCCTGGTGG + Intergenic
1170947695 20:20906356-20906378 TGATGTCACCTTGACATTGGAGG - Intergenic
1177355705 21:20003838-20003860 AGATGGCTTATGGATTTTGGAGG + Intergenic
1177558443 21:22719949-22719971 AGATGGTGCCTGGATTTGGGTGG + Intergenic
1177855694 21:26398059-26398081 AGAAGGCACCTGGATATTTGGGG - Intergenic
1179085501 21:38213232-38213254 AGCAGGCACCAGGATTTTGGGGG + Intronic
1180655794 22:17419373-17419395 AGAAGCCACCTGGGGATTGGAGG + Intronic
1180797317 22:18612175-18612197 AGGTGGTACCTGGATGTGGGAGG - Intergenic
1181224405 22:21383097-21383119 AGGTGGTACCTGGATGTGGGAGG + Intergenic
1181254227 22:21551716-21551738 AGGTGGTACCTGGATGTGGGAGG - Intronic
1183322635 22:37174439-37174461 AGATGGCCATTTGATATTGGAGG + Intronic
1184692956 22:46125628-46125650 AGATGGCACCTGTGGCTTGGTGG + Intergenic
956519857 3:70092023-70092045 AGATGCCTCTTGGATATTAGTGG - Intergenic
957219264 3:77361543-77361565 TGCTGGCACCTTGATCTTGGAGG - Intronic
959730807 3:109599519-109599541 AAATGGCACCAGAATAATGGAGG + Intergenic
964768624 3:160201949-160201971 AGAAGGGACCTGGATCTTTGGGG + Intergenic
970656283 4:18234055-18234077 AGATAGCCCCTGGATAAAGGTGG + Intergenic
971619659 4:28840020-28840042 AGATGGCACAAGTTTATTGGTGG - Intergenic
974635477 4:64558973-64558995 AGCTAGCAACTGGATATTGATGG + Intergenic
979460217 4:120973858-120973880 ATATGGCACCTTGGTATTTGAGG + Intergenic
980223527 4:129950705-129950727 AGATGGGGCCATGATATTGGGGG - Intergenic
980521985 4:133947475-133947497 AGCTGGCACCTGCTTATTGGGGG - Intergenic
981115001 4:140979696-140979718 TGAGAGCACCTGGATATTGTAGG + Intronic
984329450 4:178296787-178296809 AGTTGCCACCTGGATATTTTGGG + Intergenic
985676095 5:1232101-1232123 AGACGGGACCTGAATGTTGGGGG - Intronic
986375014 5:7122173-7122195 AGATGGCCACAGGATAATGGAGG - Intergenic
987563417 5:19554143-19554165 ACATGGCACATAGATATTTGCGG + Intronic
990244897 5:53854578-53854600 AGATGGTACCTGGAAAATCGGGG - Intergenic
992073242 5:73167963-73167985 TGATGGCAGCTGGATCATGGTGG - Intergenic
998006915 5:138663167-138663189 AGATGGCAGCTGGAGATAGGAGG - Intronic
999712194 5:154328670-154328692 AAATGGCATCTGAAGATTGGGGG - Intronic
999769270 5:154762853-154762875 AGATGGCTCCTGGCTACTGTGGG - Intronic
1000141577 5:158409514-158409536 AGCTCTCACCTGGATATTGCAGG + Intergenic
1000412340 5:160946960-160946982 AGATGGTACCTGGAAATTCAGGG - Intergenic
1001144113 5:169169103-169169125 AGCCGGCACCTAGAGATTGGAGG - Intronic
1001318091 5:170658552-170658574 AGATGGCAGATGAATTTTGGAGG + Intronic
1001594092 5:172886620-172886642 AAATGCCACGTGGATATTTGTGG - Intronic
1001686244 5:173597009-173597031 AGGGTGCACCTGGACATTGGTGG - Intergenic
1004013766 6:11713444-11713466 AAATGGCAAATGGCTATTGGTGG - Intronic
1006205805 6:32341537-32341559 AGGTGGCACCGGGCTAGTGGTGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007979477 6:46136590-46136612 AAGTTGGACCTGGATATTGGAGG + Intronic
1008248691 6:49210181-49210203 AGATGTAACCTGAATATTGTGGG + Intergenic
1009626360 6:66142588-66142610 AGAGGGGACCTGGAAATTGGAGG - Intergenic
1010376110 6:75172877-75172899 AGTTGGCCCCCGGATATAGGTGG - Intronic
1010455804 6:76052997-76053019 AGATGGCAGCAGGATGATGGAGG - Intronic
1013478202 6:110529196-110529218 AGCTGGCACCTTGATCTTGGGGG + Intergenic
1019904575 7:4052007-4052029 GGATGGCACGTGGACAGTGGAGG + Intronic
1021061706 7:16120323-16120345 AGATAGCACCTGGAAGATGGTGG - Intronic
1021968567 7:25945858-25945880 AGGTGCCAGCTGGATATTGGAGG - Intergenic
1022273689 7:28835512-28835534 TGATGCCACCTGGATATGGTGGG - Intergenic
1023727172 7:43155346-43155368 ACATGGCAACTGGAAGTTGGAGG + Intronic
1026256470 7:68716406-68716428 ACATGGCACCTGGAAATGGGTGG + Intergenic
1026497655 7:70917584-70917606 AGGTGTGAACTGGATATTGGAGG - Intergenic
1027457894 7:78416640-78416662 AGATTCCACATGGATTTTGGAGG - Intronic
1028725129 7:94077979-94078001 AGAGGGCACGTGGCTATTTGAGG - Intergenic
1031013813 7:116550941-116550963 GGATGGCATCTGGACACTGGTGG - Intronic
1033491061 7:141844464-141844486 AGATGGCACCTGCAAAATGTTGG + Intergenic
1034476664 7:151288472-151288494 AGCTGGCACTTGGATGTAGGAGG + Intergenic
1037537877 8:19843812-19843834 AGATGGCAGTTGGACATGGGTGG - Intronic
1038686111 8:29719884-29719906 ATGTGCCACCTGGATTTTGGTGG + Intergenic
1039583460 8:38685741-38685763 AGATGGCACCAGGGTGTAGGAGG + Intergenic
1039789711 8:40865544-40865566 AGATGGCAGATGGATGTTGATGG - Intronic
1041745962 8:61209804-61209826 AGATTGTACAAGGATATTGGTGG - Intronic
1042037091 8:64545598-64545620 AAATGGCACCTGTATAATGCTGG - Intergenic
1043985628 8:86692335-86692357 AGATGGCAACACGATATTAGTGG - Intronic
1044290888 8:90468023-90468045 AGTTGACCCCTGGACATTGGTGG - Intergenic
1044555886 8:93561444-93561466 CGATTTCACCTTGATATTGGAGG - Intergenic
1046042904 8:108928802-108928824 GGTAGGCACCTGGAAATTGGTGG - Intergenic
1047570860 8:126097430-126097452 AGATGGCACTTGGAGAATGATGG + Intergenic
1049360204 8:142209200-142209222 AGATGGCAGCTGGCTCCTGGGGG - Intergenic
1050327767 9:4514477-4514499 ACATGTCACATGGATCTTGGAGG + Intronic
1051494111 9:17699549-17699571 GGATGGCAGCAGGAGATTGGTGG - Intronic
1051942591 9:22526556-22526578 TGGAGGCACCTGGATTTTGGAGG - Intergenic
1053661991 9:40290727-40290749 AGTTGGGACCTGGTTAGTGGTGG + Intronic
1053912441 9:42920891-42920913 AGTTGGGACCTGGTTAGTGGTGG + Intergenic
1054374117 9:64436963-64436985 AGTTGGGACCTGGTTAGTGGTGG + Intergenic
1054522618 9:66085557-66085579 AGTTGGGACCTGGTTAGTGGTGG - Intergenic
1055583371 9:77731462-77731484 ACATGGCACCTGGTGAATGGAGG - Intronic
1055788916 9:79900557-79900579 GGATGGCACCTGGGTATATGAGG + Intergenic
1055846198 9:80566006-80566028 GGATGGCAGCTGAATATTAGAGG - Intergenic
1059216688 9:112571081-112571103 AGATCTCGCCTGAATATTGGCGG - Intronic
1059533097 9:115055973-115055995 AGATAGCAACTGGATAATGTTGG + Intronic
1061361205 9:130143391-130143413 AGTTGGGAACTGGATGTTGGGGG + Intergenic
1062075496 9:134586414-134586436 AGCTGGGACATGGATGTTGGCGG + Intergenic
1062442983 9:136579357-136579379 AGGAGGCACCTGGATTTTGAGGG - Intergenic
1186385888 X:9109953-9109975 AGATGGGACCTGGCATTTGGAGG + Intronic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1186893847 X:13986779-13986801 AGAAGGGACTTAGATATTGGGGG + Intergenic
1190100892 X:47522423-47522445 GCAGGGCACCTGGATAGTGGAGG - Intergenic
1191171710 X:57454025-57454047 AGATGGCTCCTGGGCTTTGGAGG - Intronic
1192161619 X:68792699-68792721 AGATGGCACCTGAACTTTGACGG + Intergenic
1192709517 X:73565107-73565129 AGTTGGCATCTGAATATTGTAGG - Intronic
1194575579 X:95610496-95610518 AGGTGGAACATGGAAATTGGTGG - Intergenic
1194893504 X:99409504-99409526 AGAAGACAACTGTATATTGGAGG - Intergenic
1195009297 X:100719653-100719675 AGATGGCAGGTGCATAATGGTGG + Intronic
1197880922 X:131165533-131165555 AGATGACTCCTGGAAATTTGGGG + Intergenic