ID: 1096874311

View in Genome Browser
Species Human (GRCh38)
Location 12:54615355-54615377
Sequence CACATACAGCCCCATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096874307_1096874311 3 Left 1096874307 12:54615329-54615351 CCACATGGGCTAGTGGCTCAGTG No data
Right 1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG No data
1096874302_1096874311 18 Left 1096874302 12:54615314-54615336 CCTTGGGAATGTTACCCACATGG No data
Right 1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG No data
1096874306_1096874311 4 Left 1096874306 12:54615328-54615350 CCCACATGGGCTAGTGGCTCAGT No data
Right 1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096874311 Original CRISPR CACATACAGCCCCATGAGCT GGG Intergenic
No off target data available for this crispr