ID: 1096877495

View in Genome Browser
Species Human (GRCh38)
Location 12:54641921-54641943
Sequence ACCGAAGACCCCTTTAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096877494_1096877495 20 Left 1096877494 12:54641878-54641900 CCTTAACATTTTGAGAATTAGAT 0: 1
1: 0
2: 1
3: 24
4: 355
Right 1096877495 12:54641921-54641943 ACCGAAGACCCCTTTAGAAATGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096877495 Original CRISPR ACCGAAGACCCCTTTAGAAA TGG Intergenic
903020864 1:20393163-20393185 ACCTAAAACCCCTTCAGCAAAGG + Intergenic
916650528 1:166830692-166830714 ACCGTAGCCCCTTTTAGCAATGG - Intergenic
920355043 1:205365733-205365755 CACGAAGACCACTTTAGAGAAGG - Intergenic
1064340858 10:14484047-14484069 GCCGAAGACACATTTAGAAAGGG + Intergenic
1066454554 10:35561587-35561609 ACCAAAAACCCCATTTGAAAAGG - Intronic
1070628121 10:78065759-78065781 ACCACAAACCCCTTGAGAAAAGG - Intergenic
1071303446 10:84275371-84275393 AACAAAGACCCCTTTTGAGATGG + Intergenic
1071794439 10:88990381-88990403 ACAGCAGAAGCCTTTAGAAAGGG + Intronic
1075056347 10:119221515-119221537 AACACAGACCCCTTTAGAACTGG - Intronic
1075664837 10:124222767-124222789 ACCGAGGACGCCATTTGAAAAGG + Intergenic
1085374085 11:76042147-76042169 ACCTAAATCCCCTTTAGTAAGGG + Intronic
1089068515 11:115680386-115680408 ACCTAAGACTCCTCTGGAAAGGG + Intergenic
1089098656 11:115941110-115941132 ACTGATGACCCCTTTAGCTACGG + Intergenic
1096672883 12:53210778-53210800 ACCCAAGACCCCTGGAGGAAGGG + Exonic
1096877495 12:54641921-54641943 ACCGAAGACCCCTTTAGAAATGG + Intergenic
1099368059 12:81794661-81794683 ATAGATGACCCTTTTAGAAAAGG + Intergenic
1104457771 12:128929425-128929447 ACAGAACACCCCTGAAGAAACGG - Intronic
1113750834 13:112775471-112775493 ACCTAACACCCCTTTAGAGGAGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1128775707 15:70318547-70318569 ACTGAAGTCCCCTGTAAAAATGG + Intergenic
1129910232 15:79220708-79220730 CCTGAGGACCCCTTTACAAAAGG - Intergenic
1203143299 16_KI270728v1_random:1783257-1783279 ATGGAAGACACCTTCAGAAAGGG - Intergenic
1143204904 17:5134642-5134664 ACGGAAGACCCAGTGAGAAAAGG + Intronic
1144242246 17:13323975-13323997 CCAGAAGACCCCGTTTGAAAAGG - Intergenic
1144660351 17:17064005-17064027 ACAGAAGAACCCTTGAGAGAAGG + Intronic
1144875946 17:18397324-18397346 ACAGAAGACCCAGTGAGAAAAGG + Intergenic
1145156282 17:20547096-20547118 ACAGAAGACCCAGTGAGAAAAGG - Intergenic
1145495485 17:23893797-23893819 TCCGAAGACGTCTTTGGAAACGG + Intergenic
1145524639 17:24318112-24318134 TCCGAAGACGTCTTTGGAAACGG + Intergenic
1145563014 17:24876504-24876526 TCCGAAGACATCTTTGGAAACGG + Intergenic
1145595588 17:25350145-25350167 TCCGAAGACGTCTTTGGAAACGG + Intergenic
1145627809 17:25819654-25819676 TCCGAAGACGTCTTTCGAAACGG + Intergenic
1146160633 17:30557632-30557654 ACGGAAGACCCAGTGAGAAAAGG + Exonic
1146843758 17:36171183-36171205 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1146856064 17:36259117-36259139 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1146864556 17:36329258-36329280 ACGGAAGACCCAGTGAGAAAAGG + Intronic
1146871970 17:36383028-36383050 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1146879332 17:36434113-36434135 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1146883262 17:36455258-36455280 ACAGAAGACCCAGTGAGAAAAGG - Intergenic
1147067415 17:37929846-37929868 ACGGAAGACCCAGTGAGAAAAGG + Intronic
1147074857 17:37983652-37983674 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1147078946 17:38009407-38009429 ACGGAAGACCCAGTGAGAAAAGG + Intronic
1147086380 17:38063198-38063220 ACGGAAGACCCAGTGAGAAAAGG - Intronic
1147094883 17:38133342-38133364 ACGGAAGACCCAGTGAGAAAAGG + Intergenic
1147102325 17:38187161-38187183 ACGGAAGACCCAGTGAGAAAAGG - Intergenic
1148070536 17:44906180-44906202 AAGGAAGAGGCCTTTAGAAATGG + Intronic
1149846913 17:60013668-60013690 ACGGAAGACCCAGTGAGAAAAGG - Intergenic
1150085263 17:62270245-62270267 ACGGAAGACCCAGTGAGAAAAGG - Intergenic
1151909539 17:77072981-77073003 ACTGAAGATACCTTCAGAAAGGG + Intergenic
1156874362 18:41989387-41989409 ACCCAAAACACCTTTATAAATGG - Intronic
939603062 2:144218080-144218102 ACCGTAAAACCCTTTAGCAATGG + Intronic
939873128 2:147547386-147547408 ACCCAAAAGCCCTTTAGTAAAGG + Intergenic
945915593 2:215700959-215700981 ACAGAAGACTCCACTAGAAATGG + Intergenic
1174492663 20:50912482-50912504 ACCTAAGATTCCTTTGGAAACGG - Intronic
1175749958 20:61489189-61489211 ATTGAAGACCCCCTTGGAAAGGG - Intronic
1179922565 21:44515036-44515058 CCCGCAGACCCCTCCAGAAAGGG + Intronic
959120138 3:102223080-102223102 ACCGTTCACCCCTTTGGAAAGGG - Intronic
960457627 3:117892426-117892448 ACCAAACACCCCAATAGAAATGG - Intergenic
961399356 3:126625115-126625137 TCCAAAGACCACTTTGGAAATGG + Intronic
963971201 3:151431070-151431092 ACGGAAAATCCTTTTAGAAATGG + Intronic
981717704 4:147767895-147767917 ACATTAGAGCCCTTTAGAAAGGG + Intronic
985534475 5:456168-456190 GCCCAAGTCCCCTTTATAAAAGG + Intronic
999364187 5:151011054-151011076 ACCACAGACCCCTTTAAAAAGGG + Intergenic
999442648 5:151614505-151614527 TCTCAAGCCCCCTTTAGAAAAGG - Intergenic
999666730 5:153920509-153920531 ATAGTAGACCCCTTTAGAAGGGG - Intergenic
999813823 5:155155495-155155517 ACAGAAGAGGCCTTTAGAAAAGG - Intergenic
1001124780 5:169009582-169009604 ACCTAAGCCCCTTTTAGGAAAGG - Intronic
1004010581 6:11682223-11682245 ACTGCAGATCCCTTTAGAAAAGG + Intergenic
1004802066 6:19159799-19159821 TCCTAAGACCTTTTTAGAAAGGG - Intergenic
1004863075 6:19825743-19825765 ACCTAATACCACTTTAGTAAAGG - Intergenic
1005435938 6:25812284-25812306 AGACAAGACTCCTTTAGAAATGG - Intronic
1010209747 6:73353686-73353708 TCCCAAGACCCCTTTGGGAATGG - Intronic
1011947125 6:92919694-92919716 ACTGAAGCCCGCTTTACAAAGGG + Intergenic
1017900666 6:158716161-158716183 ACTGTAGTCCCCCTTAGAAAGGG + Intronic
1017996172 6:159533430-159533452 ACAGAAGACACATTGAGAAATGG - Intergenic
1054479789 9:65651007-65651029 AACGAAGGCCGTTTTAGAAAAGG + Intergenic
1055113153 9:72579466-72579488 ACCGGAGAGCCATTTAGAAGTGG - Intronic
1058299833 9:103358377-103358399 ACTGAAACTCCCTTTAGAAATGG - Intergenic
1060473383 9:123967230-123967252 ACCGTAGACCCCTTGAGGACAGG - Intergenic
1202783629 9_KI270718v1_random:25132-25154 AACGAAGGCCGTTTTAGAAAAGG - Intergenic
1185549261 X:970307-970329 ATGGAAGACACCTTCAGAAAGGG + Intergenic
1188492919 X:30755293-30755315 ACCAAAGACTCCTTTTTAAATGG + Intergenic
1197708684 X:129651464-129651486 AAAGAATTCCCCTTTAGAAATGG + Intronic
1200892365 Y:8337482-8337504 TCACAAGTCCCCTTTAGAAAAGG - Intergenic
1202024726 Y:20509080-20509102 ACAGAGGACCTCTTAAGAAATGG - Intergenic