ID: 1096878059

View in Genome Browser
Species Human (GRCh38)
Location 12:54645746-54645768
Sequence CACTCTTTCCACCCTGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096878059 Original CRISPR CACTCTTTCCACCCTGGTCG GGG Intronic
900279664 1:1858522-1858544 CCCTCCTTCCACCCTTGTCCAGG + Intronic
904015069 1:27413449-27413471 CCCTCTTTCCACCATTGTTGGGG + Intronic
906187657 1:43873202-43873224 CACTGCTTCCACCGTGGTCCAGG - Intronic
907296742 1:53460461-53460483 CACTCTTCCCTCCCGGTTCGCGG + Intronic
911378188 1:97077321-97077343 CTCTCTTTGCACTCTTGTCGTGG - Intergenic
912158604 1:106953062-106953084 CACTCTTCCCAGCCTAGTCCTGG + Intergenic
912370553 1:109170851-109170873 CACTCTATCCACCCTGTCCACGG - Intronic
913066882 1:115264119-115264141 CACTGTCTCCACCCTAGTCCAGG + Intergenic
915215834 1:154340318-154340340 CGCTCCTTCCACCCTGGGCTTGG - Intronic
924585049 1:245354632-245354654 CACTGTGTCCACCTTGGGCGTGG + Intronic
924740112 1:246789969-246789991 CACGCTTTCCAGGCTGGTCTGGG + Intergenic
1065962724 10:30747133-30747155 CACTCTTTCCACTCTGTTTCTGG + Intergenic
1066430681 10:35348600-35348622 GACTCATCCCACCCTGGACGGGG - Intronic
1067247066 10:44556087-44556109 CACCTCTTCCACCCTGGTTGGGG - Intergenic
1069723065 10:70561754-70561776 CACTCTGCCCACCCTGGGAGGGG + Intronic
1069846814 10:71377686-71377708 CACTCATTCCTACCTGGTCTTGG + Intergenic
1070339992 10:75489135-75489157 AACTCTTTACTCCATGGTCGAGG - Intronic
1074186615 10:111103757-111103779 CACTCTCTCCACCCTGCACTTGG - Intergenic
1076034073 10:127184416-127184438 CACTGTTCCCACCCTGATCTTGG + Intronic
1077488409 11:2849605-2849627 CACTCTTTCCACCTTAGGAGAGG - Intergenic
1081744518 11:45463499-45463521 ACCTCTTCCCACTCTGGTCGGGG + Intergenic
1083955219 11:65979088-65979110 TATTTTTTCCTCCCTGGTCGTGG + Exonic
1084466959 11:69328952-69328974 CACCATGTCCACCCTGGTCTTGG - Intronic
1085255366 11:75169558-75169580 CACTCTGTCTCCCCTGGTCAGGG - Intronic
1086533141 11:87810658-87810680 CATTCTTTCCACTGTGGTAGGGG + Intergenic
1086550955 11:88051160-88051182 CACTTTTTTCACCCTGGTCTTGG + Intergenic
1087380950 11:97404042-97404064 CCCTCTTCCCACCCTGCTCCAGG + Intergenic
1089031380 11:115332975-115332997 CACTCTATACACCCTGTGCGAGG + Intronic
1095463164 12:42463265-42463287 CACTCTTGTCACCCAGGTTGGGG - Intronic
1096052406 12:48622642-48622664 CAGTCTTTCTACCCTGGCCTGGG - Intergenic
1096878059 12:54645746-54645768 CACTCTTTCCACCCTGGTCGGGG + Intronic
1096956869 12:55534904-55534926 TTCTCTATCCACCCTGGTCGTGG + Intergenic
1097192405 12:57225846-57225868 CACTCCTTCCACTCTGGGGGCGG + Exonic
1102540812 12:113617880-113617902 CTCCCTTTTCACCCTGGTCGTGG + Intergenic
1102915631 12:116750032-116750054 CCCTCCTTCCTCCCTGGACGCGG - Exonic
1103003275 12:117402384-117402406 CACTATGTCCACCCTCCTCGAGG - Intronic
1103685605 12:122729943-122729965 CACTATCTCCACCCGGGTGGCGG - Exonic
1111275798 13:85945512-85945534 CACTCTTTCCATCATGGAAGAGG - Intergenic
1117309000 14:54503510-54503532 CACTGTTTCCACCTTGGTCCAGG - Intergenic
1118351151 14:64972887-64972909 CTATCTTTTCACCCTGGTGGAGG - Intronic
1118596513 14:67439868-67439890 CACTCTGTCCACCCAGGCTGGGG + Intergenic
1119730299 14:76947105-76947127 CCCTCTTTCCACACTGGACCAGG + Intergenic
1119951183 14:78747128-78747150 CAGACTTTCAACCCTGGTCCTGG - Intronic
1121330803 14:93048656-93048678 CACTCTTTCCCAGCTGGGCGCGG + Intronic
1122218265 14:100218623-100218645 CAGTCTCCCCACCCTGGTCCTGG + Intergenic
1128384455 15:67137475-67137497 CATTCTTTCCACCATTGTCCTGG + Intronic
1130766575 15:86877270-86877292 TACTCTTTCCATCCAGGTTGGGG - Intronic
1132337506 15:101057887-101057909 CCCTCATTCCTCCCTGGTTGGGG + Intronic
1133826708 16:9284422-9284444 CAGTGTTTCCACCTTGGTCTTGG + Intergenic
1137441012 16:48498455-48498477 CTCCATTTCCACCCTGGTGGGGG - Intergenic
1137714393 16:50589498-50589520 CACTCTAGTCAGCCTGGTCGGGG + Intronic
1140033788 16:71358182-71358204 CACTCTTTCCACGCCGCACGTGG - Intergenic
1144731032 17:17526451-17526473 CCCTCCTTCCACGCTGGCCGGGG - Intronic
1145106998 17:20126097-20126119 AACTCTTTCCATCCAGGTCCTGG + Intronic
1146641341 17:34543981-34544003 CACTCTCTCCACCCTCCTCTGGG + Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1153218049 18:2838155-2838177 CAGTCTTTCCACCTTTGTCTGGG - Intergenic
1154466143 18:14643730-14643752 CACTCCTTCCATCCTGTTCTAGG + Intergenic
1156469839 18:37370340-37370362 CACTCTTCCCACCTTGGTCTTGG + Intronic
1161426330 19:4205501-4205523 CCCTGTTTCCACTCTGGTCCTGG + Intronic
1163611024 19:18301647-18301669 CTCAGTTTCCTCCCTGGTCGGGG - Intergenic
1163674818 19:18650320-18650342 CACTCCTTCCACCCCGCTCCGGG - Intronic
1166980274 19:46627883-46627905 CACTCTCTCCACCCATGGCGAGG + Intergenic
935275861 2:101474635-101474657 CACCTTTTCCAATCTGGTCGCGG + Exonic
936489286 2:112956606-112956628 CACTCTGTGCACCCTGGTCCAGG + Intergenic
946012072 2:216573365-216573387 CACTTTTTCCATGCTGGGCGAGG - Intronic
1169801681 20:9517468-9517490 CACTCTGTCCACCAGGGTGGAGG + Intronic
1171105103 20:22425911-22425933 CACTCTTTCATCCCTGGTGATGG - Intergenic
1171235409 20:23520438-23520460 CCCTCTTTCCTCCCTGGAGGTGG + Intergenic
1175339676 20:58220384-58220406 CACTCTATCCTCCCTGGATGTGG - Intronic
1176808444 21:13514866-13514888 CACTCCTTCCATCCTGTTCTAGG - Intergenic
1178763972 21:35432016-35432038 CATTCTTTTCATCCTGGTCCAGG - Intronic
1183860614 22:40667347-40667369 CACCCTTTCCACCCTGCCCTGGG + Intergenic
953354679 3:42245584-42245606 CACTGTTGCCACCTTGGTCTGGG - Intergenic
954213298 3:49110362-49110384 CACTCTTCCCACCCTGCTGTAGG - Exonic
954318290 3:49813162-49813184 CACTGTGTCCACCCAGGTGGTGG - Exonic
954326012 3:49864436-49864458 CACTCTTTCCACCTGGGGCACGG + Intronic
955084344 3:55688246-55688268 CACTCTTTCTAACCTGGAGGAGG - Intronic
956705540 3:71995945-71995967 CACCCTTTCCTCTCTGGTCTAGG - Intergenic
965205530 3:165716006-165716028 AACTCTTTCCAACATAGTCGGGG + Intergenic
973722216 4:53735978-53736000 CAATCATTCCACCCTGGCCCTGG - Intronic
980236605 4:130115304-130115326 CACTCTTTCAACATTGGTCTGGG + Intergenic
983392481 4:167150489-167150511 CACTCTTTCCACCCTCTTTCAGG - Intronic
986072283 5:4296950-4296972 CCCTCTGTCCTCCATGGTCGGGG - Intergenic
987381091 5:17286829-17286851 CAGTCTTGCCACCCTGGCCCAGG + Intergenic
989715532 5:44458207-44458229 CTCCCTTTCCATCCTGGTGGGGG - Intergenic
993831863 5:92770314-92770336 CACTCTTTCACCTCTGGTGGTGG + Intergenic
1001035450 5:168293003-168293025 CTCTCTTTCTTCCCTGATCGGGG + Intronic
1003158728 6:3617968-3617990 CAGCCTTTCCACCCTTGCCGGGG + Intergenic
1005664214 6:28034228-28034250 CACTCTTGCCACCCAGGCCCAGG - Intergenic
1006594226 6:35181305-35181327 CTCTCTTGCAACCCTGGTCATGG + Intergenic
1010380986 6:75224671-75224693 GACTCTTTCCAGCCTGGATGAGG - Intergenic
1013298334 6:108780278-108780300 CTCTCATCCCACCCTGCTCGCGG - Intergenic
1022006540 7:26271093-26271115 CACTCTTGTCACCCAGGCCGGGG + Intergenic
1022248866 7:28586968-28586990 CACTCTTTCCACCTTGGGTCTGG - Intronic
1022777689 7:33544779-33544801 CTCCCTATCCACCCTGGTAGTGG - Intronic
1025013122 7:55415258-55415280 CACTCGTGTCACCCTGGTGGGGG - Intronic
1028600497 7:92595491-92595513 CTCTCGTTCCACCCTTGTTGAGG + Intergenic
1029868889 7:103666745-103666767 CATTCATTCCACCCAGGTGGTGG - Intronic
1033222466 7:139537570-139537592 CACTCTTCCCTCCCTGGTTTAGG + Intronic
1036093909 8:5702440-5702462 CACACTTCCCACGCTGGTCATGG - Intergenic
1037294798 8:17388809-17388831 CACTCTGTCCACCCAGGCCAAGG + Intronic
1044433863 8:92139514-92139536 CATTCTTTCCTCCCTAGTCACGG + Intergenic
1048879855 8:138863363-138863385 TACTCTTCCCTCCCTGGTTGTGG + Intronic
1049682579 8:143926268-143926290 CAGGCTTCCCACCCTGGTCGGGG - Intronic
1060966179 9:127713431-127713453 CACTCTTTCCCTGCTGGTGGGGG - Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1186675449 X:11812192-11812214 CACTAATACCACCCTGGTCTTGG + Intergenic
1187525855 X:20054514-20054536 CACTCATTTCACCCTGGCCCGGG + Intronic
1187647465 X:21363975-21363997 GACTCTGTCCACCATGGTGGTGG + Intergenic
1193420828 X:81280232-81280254 TTCCCTTTCCACCCTGGTAGTGG + Intronic
1195245990 X:102995789-102995811 CACTCTTTCTACCATGGCCAGGG + Intergenic
1199521492 X:148741226-148741248 TTCTCTATCCACCCTGGTAGTGG - Intronic