ID: 1096879674

View in Genome Browser
Species Human (GRCh38)
Location 12:54657695-54657717
Sequence ACATTCCAGACCACTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096879673_1096879674 -2 Left 1096879673 12:54657674-54657696 CCTTAAATAAAGTCATGCTAAAC No data
Right 1096879674 12:54657695-54657717 ACATTCCAGACCACTTCTGCTGG No data
1096879672_1096879674 11 Left 1096879672 12:54657661-54657683 CCATCTTTATTCTCCTTAAATAA No data
Right 1096879674 12:54657695-54657717 ACATTCCAGACCACTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096879674 Original CRISPR ACATTCCAGACCACTTCTGC TGG Intergenic
No off target data available for this crispr