ID: 1096879678

View in Genome Browser
Species Human (GRCh38)
Location 12:54657717-54657739
Sequence GGTTAAGTGTGTTAATCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096879676_1096879678 -6 Left 1096879676 12:54657700-54657722 CCAGACCACTTCTGCTGGGTTAA No data
Right 1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG No data
1096879673_1096879678 20 Left 1096879673 12:54657674-54657696 CCTTAAATAAAGTCATGCTAAAC No data
Right 1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096879678 Original CRISPR GGTTAAGTGTGTTAATCTAA AGG Intergenic
No off target data available for this crispr