ID: 1096880274

View in Genome Browser
Species Human (GRCh38)
Location 12:54662004-54662026
Sequence AAAAAGGATTTCCCTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096880274_1096880282 17 Left 1096880274 12:54662004-54662026 CCCTGTGTAGGGAAATCCTTTTT No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096880274 Original CRISPR AAAAAGGATTTCCCTACACA GGG (reversed) Intergenic
No off target data available for this crispr