ID: 1096880282

View in Genome Browser
Species Human (GRCh38)
Location 12:54662044-54662066
Sequence TTTTCTATCAAAGACCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096880271_1096880282 28 Left 1096880271 12:54661993-54662015 CCTAACCTGGGCCCTGTGTAGGG No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data
1096880278_1096880282 1 Left 1096880278 12:54662020-54662042 CCTTTTTGGAGACCTCTGGTACC No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data
1096880273_1096880282 23 Left 1096880273 12:54661998-54662020 CCTGGGCCCTGTGTAGGGAAATC No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data
1096880275_1096880282 16 Left 1096880275 12:54662005-54662027 CCTGTGTAGGGAAATCCTTTTTG No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data
1096880274_1096880282 17 Left 1096880274 12:54662004-54662026 CCCTGTGTAGGGAAATCCTTTTT No data
Right 1096880282 12:54662044-54662066 TTTTCTATCAAAGACCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096880282 Original CRISPR TTTTCTATCAAAGACCCCAT TGG Intergenic
No off target data available for this crispr