ID: 1096880633

View in Genome Browser
Species Human (GRCh38)
Location 12:54666200-54666222
Sequence CTGTAAACACAAAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096880633_1096880639 -7 Left 1096880633 12:54666200-54666222 CCCTCCCCTTTTTGTGTTTACAG No data
Right 1096880639 12:54666216-54666238 TTTACAGAGTGACTGGTTGAAGG No data
1096880633_1096880640 4 Left 1096880633 12:54666200-54666222 CCCTCCCCTTTTTGTGTTTACAG No data
Right 1096880640 12:54666227-54666249 ACTGGTTGAAGGATGTGCCCTGG No data
1096880633_1096880641 17 Left 1096880633 12:54666200-54666222 CCCTCCCCTTTTTGTGTTTACAG No data
Right 1096880641 12:54666240-54666262 TGTGCCCTGGAGTGAGCAAATGG No data
1096880633_1096880645 24 Left 1096880633 12:54666200-54666222 CCCTCCCCTTTTTGTGTTTACAG No data
Right 1096880645 12:54666247-54666269 TGGAGTGAGCAAATGGAGGAAGG No data
1096880633_1096880642 20 Left 1096880633 12:54666200-54666222 CCCTCCCCTTTTTGTGTTTACAG No data
Right 1096880642 12:54666243-54666265 GCCCTGGAGTGAGCAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096880633 Original CRISPR CTGTAAACACAAAAAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr