ID: 1096881594

View in Genome Browser
Species Human (GRCh38)
Location 12:54677388-54677410
Sequence GGCTCCTAGAAGACAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096881590_1096881594 -9 Left 1096881590 12:54677374-54677396 CCCCAAAACTATAAGGCTCCTAG No data
Right 1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG No data
1096881591_1096881594 -10 Left 1096881591 12:54677375-54677397 CCCAAAACTATAAGGCTCCTAGA No data
Right 1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG No data
1096881588_1096881594 22 Left 1096881588 12:54677343-54677365 CCTAGACTGGATTAAAGATTTAA No data
Right 1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096881594 Original CRISPR GGCTCCTAGAAGACAACACA GGG Intergenic
No off target data available for this crispr