ID: 1096882920

View in Genome Browser
Species Human (GRCh38)
Location 12:54687218-54687240
Sequence GGACCCTGGACCCACTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 8, 3: 10, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096882915_1096882920 20 Left 1096882915 12:54687175-54687197 CCCTCCTGGATACTTCATGGTCT 0: 1
1: 0
2: 0
3: 19
4: 353
Right 1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG 0: 1
1: 0
2: 8
3: 10
4: 152
1096882916_1096882920 19 Left 1096882916 12:54687176-54687198 CCTCCTGGATACTTCATGGTCTC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG 0: 1
1: 0
2: 8
3: 10
4: 152
1096882917_1096882920 16 Left 1096882917 12:54687179-54687201 CCTGGATACTTCATGGTCTCTAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG 0: 1
1: 0
2: 8
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096882920 Original CRISPR GGACCCTGGACCCACTCTGA AGG Intergenic
902702084 1:18179344-18179366 GGACAGTGGCCCCTCTCTGAGGG - Intronic
913990909 1:143610766-143610788 GTACCCAGTACCCGCTCTGAAGG - Intergenic
915931657 1:160064192-160064214 GGTCCCTGGACCCTTTCGGAGGG + Intronic
916523580 1:165588274-165588296 GGACACTGGACCCAGTTTGGTGG - Intergenic
917576184 1:176323943-176323965 TGAACCTGGACCCACTCAGTTGG + Intergenic
918520411 1:185408663-185408685 AGATCATGGACCCACTATGAGGG - Intergenic
919430647 1:197487355-197487377 GGTACCAGCACCCACTCTGATGG - Intergenic
921290929 1:213656648-213656670 GGACCCTGGACCCAGAATCAGGG - Intergenic
921395255 1:214662361-214662383 GTGTCCTGGACACACTCTGAGGG + Intronic
922232520 1:223699421-223699443 GGACCCTGGAACACCTGTGATGG + Intergenic
1062970055 10:1640457-1640479 GGCCCCTGGAGCCCCTCTAATGG - Intronic
1071288691 10:84172656-84172678 GGAACTCAGACCCACTCTGATGG + Intergenic
1074141748 10:110679672-110679694 AGCCCCTGGATCCTCTCTGAAGG + Intronic
1074884381 10:117683312-117683334 AGCCCCTGAACCCAGTCTGATGG + Intergenic
1076228749 10:128802618-128802640 GGAGCCTGCACCCACTCTGTAGG + Intergenic
1076901829 10:133343149-133343171 GGCCGCGGGACCCACTCTGCTGG + Intronic
1077022233 11:422532-422554 GGACTCAGGACTCACTCAGAAGG + Intronic
1077234331 11:1472636-1472658 GGACCCAGGCTCCACTCTGGAGG + Intronic
1077335507 11:2002022-2002044 GGCCCCAGGTCACACTCTGAGGG - Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1078486280 11:11726260-11726282 GGACCCTGCCCCAACTCTGCAGG + Intergenic
1085042284 11:73333671-73333693 GGACCCGGGTGACACTCTGAGGG - Intronic
1089044987 11:115493193-115493215 GGATACAGGAGCCACTCTGAAGG + Intronic
1089351473 11:117823932-117823954 GGACCCAGGTCCCACACAGAAGG + Intronic
1089522357 11:119073583-119073605 GGAGCCTGAGCCCACTCTAAGGG + Intronic
1202818491 11_KI270721v1_random:57204-57226 GGCCCCAGGTCACACTCTGAGGG - Intergenic
1091884559 12:4006818-4006840 TGAGGCTGGACCCACCCTGAAGG - Intergenic
1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG + Intergenic
1100260275 12:92926851-92926873 GGACCCAGGAGGCACTCTGTGGG - Intronic
1102121798 12:110447825-110447847 GCACCCTGGATTCACTCTGTTGG - Intronic
1103186332 12:118960965-118960987 GGATCCTTGGCCCAGTCTGAGGG - Intergenic
1104759588 12:131288956-131288978 GCATCCTGGACCCACTCACAAGG + Intergenic
1104821125 12:131678256-131678278 GCATCCTGGACCCACTCACAGGG - Intergenic
1104866408 12:131958253-131958275 GTCCCCTGCACCCACTCTGATGG + Intronic
1108225428 13:48284664-48284686 GGACCATTTACCAACTCTGAAGG - Intergenic
1108992641 13:56681402-56681424 GGAACCTGAAGCAACTCTGAAGG - Intergenic
1113900407 13:113793794-113793816 GCGCCCTGGACCGGCTCTGATGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1119720095 14:76884666-76884688 TGACCCTGGCCCAACTGTGAGGG - Intergenic
1119772871 14:77232055-77232077 GATCCCTGAACCCACTCTGTTGG + Intronic
1122785413 14:104161185-104161207 GGACCCTGGACCCCAGCTGGAGG - Intronic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1123705957 15:22951379-22951401 GGACCCTGCACCCACCCGGCCGG - Intronic
1124177881 15:27442937-27442959 GGGCCCTGTCCCCGCTCTGATGG - Intronic
1129140890 15:73597007-73597029 GGGTGCTGGACTCACTCTGAAGG + Exonic
1133254278 16:4507084-4507106 TGCCCCTGGAGCCACTCTGAGGG + Intronic
1133829047 16:9304970-9304992 AGTCCCAGGACACACTCTGATGG - Intergenic
1134234102 16:12452085-12452107 GGGTGCTGGACCCACCCTGAGGG + Intronic
1136568825 16:31084923-31084945 GGAGCCTACACCCACCCTGAGGG - Exonic
1136594913 16:31241574-31241596 GGACCCAGGTCCCACCCTGATGG - Intergenic
1137578532 16:49619976-49619998 GGACCCTGGCCCCGTGCTGAAGG - Intronic
1141510502 16:84509101-84509123 TGACCCTGCACTCACTCTAAGGG - Intronic
1141715119 16:85722577-85722599 GGGCCCTGGGCCCACTCAGCGGG - Intronic
1143090531 17:4446955-4446977 GGAAGCTGGACTCACTCGGAGGG - Exonic
1143319545 17:6059293-6059315 GGACCCTGGGCCCCCTCTCCGGG - Intronic
1143618410 17:8067311-8067333 GGACCCTGGGACCAGTCTGCAGG + Intergenic
1146812893 17:35917875-35917897 GGGCCCTGGACCCACTCCAGAGG + Intergenic
1150248421 17:63692667-63692689 GGAAGCAGGATCCACTCTGAAGG + Intronic
1152095889 17:78271447-78271469 GAACCCTGGGCCCGCTCTCAGGG - Intergenic
1158129402 18:54136212-54136234 GGACCCTGGCACCACACTGCTGG + Intergenic
1158281335 18:55831702-55831724 GGACCCTGGAGTCAAGCTGAAGG - Intergenic
1160425820 18:78778375-78778397 GGCCCCTGGACCCAGTCTTGGGG + Intergenic
1160684428 19:426912-426934 GGACCCTGGACCCGCGCTATGGG + Intronic
1160901910 19:1433014-1433036 GCACCCGGGACCCACACCGAGGG - Intronic
1162398890 19:10432760-10432782 GGACCCAGCACCCACTTTGAGGG - Intronic
1163734704 19:18972550-18972572 GGCCCCAAGACCCACGCTGAAGG - Intergenic
1164593269 19:29517743-29517765 GGCCCCAGGACCCATTCTCAGGG + Intergenic
1165950912 19:39473514-39473536 GAACCCTGGACTCACCGTGACGG - Exonic
1166185222 19:41135181-41135203 GGGCCCAGGAGACACTCTGAGGG + Intergenic
1166373320 19:42314100-42314122 GAATCCTGGACCCACAGTGACGG + Intronic
1168676874 19:58284973-58284995 GGAGCATGGACCCTGTCTGAAGG - Intronic
925569006 2:5289029-5289051 GGACCCTGGGTCCACTCTGAGGG + Intergenic
927228103 2:20790207-20790229 TGACCCTGCACTCACTCTAAAGG + Intronic
927310889 2:21629974-21629996 GGGCCCTGGATCCACTTTAAAGG - Intergenic
928856947 2:35813924-35813946 TGACCCTGGACCCATAGTGAAGG - Intergenic
929764105 2:44829962-44829984 GAGGCCTGGCCCCACTCTGAGGG - Intergenic
932781053 2:74558729-74558751 GGATCCTTCTCCCACTCTGAAGG + Exonic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
937284974 2:120744864-120744886 GATTCCTGGACCCACTCTGCAGG - Intronic
938127419 2:128684661-128684683 GGGCCCAGGGCCCCCTCTGATGG + Intergenic
938560599 2:132469162-132469184 GGCCTCTGGCCCCACTCAGAGGG - Intronic
948708251 2:239809232-239809254 GGACCCTGGACATTCTCTAAGGG + Intergenic
948975501 2:241461241-241461263 AGATCCTGGACACATTCTGAAGG - Intronic
1169905322 20:10597265-10597287 GGACCCTCACCCCACTCTGGTGG + Intronic
1171448782 20:25222260-25222282 GAACCCTGGAAGCACTCGGAAGG + Intronic
1172190703 20:33060298-33060320 TGACCCTGGGCCCGCTCTGGCGG - Intronic
1172731714 20:37094523-37094545 GGGCGCTGGACCCACTCCCAGGG - Intronic
1173161839 20:40658616-40658638 GGACTCTTGCCCCACTCTGCAGG - Intergenic
1174516759 20:51098555-51098577 GTACCCTGGACCCACCACGATGG + Intergenic
1175743270 20:61435648-61435670 GGACCCGGGAGCCGCTCTGTGGG - Intronic
1175883982 20:62277956-62277978 GGACCCTAAACCCTTTCTGAAGG - Intronic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179874535 21:44261454-44261476 GGACCCTTGAGCCCCTCTCAGGG - Intronic
1180624022 22:17181971-17181993 CCACCCTGTAGCCACTCTGATGG - Exonic
1181595791 22:23913715-23913737 GGACTCTAGACTCCCTCTGAAGG + Intergenic
1181599555 22:23941393-23941415 GGGCCCTGGACTCAATCTGGGGG + Intergenic
1184837470 22:47032405-47032427 AGGCCCTGGACCCAGTCTGGGGG - Intronic
953056953 3:39395721-39395743 GGATCCTGGATCCAGGCTGAAGG - Intronic
953571682 3:44076408-44076430 GGACCCTAGGCTCACTCTGCAGG - Intergenic
954119788 3:48490432-48490454 GCCCTCTGGACCCACTGTGATGG - Intronic
954264386 3:49461399-49461421 TGACGCTGGGCCCTCTCTGATGG + Intergenic
954568972 3:51624693-51624715 GGACACTGGAGCCAGACTGATGG - Intronic
954881976 3:53842757-53842779 AGACCCTGAAGCCACACTGAGGG - Intronic
955416474 3:58696561-58696583 GGACCTTGGACCCAGTGTGGGGG - Intergenic
955475036 3:59327754-59327776 GGTCCCTGGACCCGCACTGTTGG + Intergenic
959055916 3:101567618-101567640 GGACCTTGAACCCTCTCTCAAGG - Intergenic
959511901 3:107223052-107223074 GGACACAGGAAACACTCTGAAGG + Intergenic
960898627 3:122532059-122532081 GGACCCTGGCCTGACTCTGGTGG + Intronic
961604177 3:128081593-128081615 GGCTCCTGGACCCTCTCTGATGG - Intronic
962840032 3:139224871-139224893 GCACCCTGGACCCTCTCTTCAGG - Intronic
964483942 3:157168044-157168066 GGGCCCTGGACCCTCTATTAGGG - Intergenic
968673524 4:1864779-1864801 GGACCCAGGCCCCGCTCCGATGG + Intergenic
968819393 4:2838063-2838085 CTTCCCTGGCCCCACTCTGAGGG + Exonic
969285054 4:6197917-6197939 GGACCGTGGCCCCACTCTCTTGG - Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
970347674 4:15169422-15169444 GTACCCTGGAAACACTCAGAGGG - Intergenic
971251453 4:24976226-24976248 GGACCCTGGAATTACTCTAAGGG - Intronic
975880301 4:78898209-78898231 AGACCCTAGACCCACCCTGTGGG + Intronic
975949667 4:79754438-79754460 GGACTCAGGACCCAGGCTGAAGG - Intergenic
983459625 4:168011827-168011849 GTACCTTGGACTCTCTCTGAGGG - Intergenic
984600689 4:181722944-181722966 GGACAGTGGAACCACTCTCAGGG + Intergenic
985313183 4:188626180-188626202 GGACCCTTGACTCATTTTGATGG - Intergenic
985558431 5:569485-569507 GGCCCCGGGGCCCTCTCTGATGG + Intergenic
1001575199 5:172758694-172758716 GGACCCAGGACCCACCCAGGAGG + Intergenic
1006333546 6:33409192-33409214 GGACACTGGCACCAATCTGAAGG - Intronic
1007822225 6:44569133-44569155 GGACCAGGGGCCCACTCTAATGG - Intergenic
1013018048 6:106179127-106179149 GGTCTCTGGACCCATTCTGCTGG + Intergenic
1013638934 6:112054328-112054350 GGACCGTGGAGCCACCCTGAGGG - Exonic
1017182768 6:151569677-151569699 GGAACCAGAATCCACTCTGATGG + Intronic
1017284438 6:152658199-152658221 GGGCCCTTAACCCACTGTGATGG - Intergenic
1019103608 6:169650886-169650908 GCACCCTGGACCCTCTCATAAGG - Intronic
1019350727 7:552782-552804 TGACCTTGGACCAACTCTCAAGG + Intronic
1019368827 7:650267-650289 GGACTGTGGACCCTGTCTGAGGG + Intronic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1024409433 7:49023075-49023097 GGACCCTGGACACAAAGTGAGGG + Intergenic
1029459134 7:100685396-100685418 CCACCCTGGGCCCACTCTGGGGG - Exonic
1036686180 8:10913294-10913316 GGACCCTGGCCAGACTCTGGGGG - Intronic
1039851073 8:41365493-41365515 GGACCCTTGACGCAGTATGATGG + Intergenic
1041477655 8:58283549-58283571 TGACCCTGGGCTCACTGTGAAGG + Intergenic
1041710455 8:60889570-60889592 GAACCCTGAACCCCCACTGACGG - Intergenic
1046830572 8:118741467-118741489 GGAGCATGTACCCACCCTGATGG + Intergenic
1047578813 8:126189788-126189810 GGAACCTGTTGCCACTCTGATGG + Intergenic
1048209648 8:132444085-132444107 GGACCCTGGAACCAGACTGCTGG - Intronic
1048536863 8:135304648-135304670 GGAACCTGGACCAGCTCTCAGGG - Intergenic
1048970213 8:139641254-139641276 GCACCCAGCACCCACTCTCAGGG + Intronic
1050027356 9:1349744-1349766 AGAGACTGGACCCACTCAGAGGG + Intergenic
1055463412 9:76540518-76540540 GGACACAGGAGCCACCCTGAAGG - Intergenic
1056340517 9:85626654-85626676 GACCCCTGTAGCCACTCTGAAGG - Intronic
1056482118 9:87016258-87016280 AGACCCTGGATCTATTCTGAAGG + Intergenic
1058702775 9:107614586-107614608 AGACCCTGGACACTCTCTCAGGG + Intergenic
1059506120 9:114801274-114801296 GGCCTGTGGACCCAATCTGAGGG + Intronic
1060938450 9:127529297-127529319 GCCCCGTGGCCCCACTCTGAGGG - Intronic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1192218058 X:69177692-69177714 GGACCCTGGGCCCACTCTGTAGG + Intergenic
1195265127 X:103172574-103172596 GTTCCCTGGACCCCCTCAGAGGG + Intergenic
1195422297 X:104689022-104689044 GGTCTCTGGACCAACTTTGAAGG - Intronic
1196858216 X:120003009-120003031 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1196860031 X:120017877-120017899 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1197082897 X:122440572-122440594 GGAGCCTGGATCCACTGTGGTGG + Intergenic
1200023595 X:153234370-153234392 GGACTCTGGAACCACACTGCTGG - Intergenic
1200692214 Y:6317807-6317829 ATACCCTGGACCCAGTCTGAAGG - Intergenic
1200713498 Y:6511136-6511158 AGACCCTGGACCCAGTCTGAAGG + Intergenic
1200941727 Y:8789508-8789530 ATATCCTGGACCCAGTCTGAAGG + Intergenic
1201020430 Y:9650905-9650927 AGACCCTGGACCCAGTCTGAAGG - Intergenic
1201043058 Y:9856920-9856942 ATACCCTGGACCCAGTCTGAAGG + Intergenic
1202162756 Y:21952620-21952642 AGACCCTGGACCCAGTCTGAAGG - Intergenic
1202228600 Y:22633748-22633770 AGACCCTGGACCCAGTCTGAAGG + Intergenic
1202314557 Y:23562419-23562441 AGACCCTGGACCCAGTCTGAAGG - Intergenic
1202556245 Y:26108176-26108198 AGACCCTGGACCCAGTCTGAAGG + Intergenic