ID: 1096883788

View in Genome Browser
Species Human (GRCh38)
Location 12:54696673-54696695
Sequence ATGGTGAAGCAGAAAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096883783_1096883788 23 Left 1096883783 12:54696627-54696649 CCTAGCAGCCACCTTGTGACTTT No data
Right 1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG No data
1096883784_1096883788 15 Left 1096883784 12:54696635-54696657 CCACCTTGTGACTTTGAAAAAAA No data
Right 1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG No data
1096883785_1096883788 12 Left 1096883785 12:54696638-54696660 CCTTGTGACTTTGAAAAAAAAAT No data
Right 1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG No data
1096883782_1096883788 24 Left 1096883782 12:54696626-54696648 CCCTAGCAGCCACCTTGTGACTT No data
Right 1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096883788 Original CRISPR ATGGTGAAGCAGAAAGAGAG TGG Intergenic
No off target data available for this crispr