ID: 1096884816

View in Genome Browser
Species Human (GRCh38)
Location 12:54706639-54706661
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096884816_1096884822 -10 Left 1096884816 12:54706639-54706661 CCTTTATGTTATTTCTCCGAGGC No data
Right 1096884822 12:54706652-54706674 TCTCCGAGGCTGGGGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096884816 Original CRISPR GCCTCGGAGAAATAACATAA AGG (reversed) Intergenic
No off target data available for this crispr