ID: 1096889449

View in Genome Browser
Species Human (GRCh38)
Location 12:54752997-54753019
Sequence CTATATTAGTAGTGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096889445_1096889449 17 Left 1096889445 12:54752957-54752979 CCTTCTGACTAAAGATGGACATC No data
Right 1096889449 12:54752997-54753019 CTATATTAGTAGTGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096889449 Original CRISPR CTATATTAGTAGTGGGAGAA GGG Intergenic
No off target data available for this crispr