ID: 1096895001

View in Genome Browser
Species Human (GRCh38)
Location 12:54812603-54812625
Sequence GGTACAAGTGCACACCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096894997_1096895001 27 Left 1096894997 12:54812553-54812575 CCCTGATGGGGGCTGCTTTCTTT No data
Right 1096895001 12:54812603-54812625 GGTACAAGTGCACACCGTGCAGG No data
1096894998_1096895001 26 Left 1096894998 12:54812554-54812576 CCTGATGGGGGCTGCTTTCTTTT No data
Right 1096895001 12:54812603-54812625 GGTACAAGTGCACACCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096895001 Original CRISPR GGTACAAGTGCACACCGTGC AGG Intergenic
No off target data available for this crispr