ID: 1096896130

View in Genome Browser
Species Human (GRCh38)
Location 12:54821937-54821959
Sequence CAGCCTAAGGATCCTGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096896130_1096896137 14 Left 1096896130 12:54821937-54821959 CCACCTCCAGGATCCTTAGGCTG No data
Right 1096896137 12:54821974-54821996 GGCATCTTCCACCCACTCTCTGG No data
1096896130_1096896135 -7 Left 1096896130 12:54821937-54821959 CCACCTCCAGGATCCTTAGGCTG No data
Right 1096896135 12:54821953-54821975 TAGGCTGCATCCTGCTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096896130 Original CRISPR CAGCCTAAGGATCCTGGAGG TGG (reversed) Intergenic
No off target data available for this crispr