ID: 1096896958

View in Genome Browser
Species Human (GRCh38)
Location 12:54830665-54830687
Sequence CAGAATGAACAGAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 518}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096896958 Original CRISPR CAGAATGAACAGAGGGATGA AGG (reversed) Intronic
900279643 1:1858424-1858446 CAGGAAGAACCCAGGGATGAGGG - Intronic
900640128 1:3684551-3684573 CAGAACGAACAGAGTGAAGCGGG + Intronic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902076913 1:13794315-13794337 CAGAATGTACAGAAGGCTTAAGG - Intronic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903319245 1:22532207-22532229 CAGAGTGAACAGTGGTACGAGGG + Intergenic
903778124 1:25806122-25806144 CAGCACGAACAGAGGCCTGAAGG + Intronic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905778935 1:40691319-40691341 GAGAAAGAACTGGGGGATGAAGG - Intergenic
905993371 1:42359510-42359532 CAGCTTCAACAGTGGGATGAGGG - Intergenic
906194177 1:43919735-43919757 CAGAATGGACACTGGGATGTCGG + Intronic
906794764 1:48688110-48688132 AAGAAGGAAGGGAGGGATGAAGG + Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
907952302 1:59195594-59195616 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
908637452 1:66184024-66184046 CAAGATGATCTGAGGGATGATGG + Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909225004 1:73008295-73008317 CAGCATGAAAAGAGGTATAATGG + Intergenic
909237714 1:73174956-73174978 AGGAAAGAAGAGAGGGATGAGGG - Intergenic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
914733409 1:150392871-150392893 CAAAAGGTACAGAGGTATGAAGG + Intronic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
915602536 1:156931195-156931217 CTGACAGAACGGAGGGATGAGGG - Intronic
916604855 1:166330979-166331001 CAGAAAGGCCAGAGGAATGAAGG + Intergenic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917242818 1:172967359-172967381 CAAAATGAACCCATGGATGAGGG - Intergenic
917845304 1:179015376-179015398 CAGTATGAACAGAGACATGGAGG - Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
920277930 1:204821782-204821804 GAGAATGAACAGACCGAAGAAGG - Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922794983 1:228335425-228335447 GAGAATGAAAAGAGGAAGGAGGG - Intronic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923613626 1:235517998-235518020 CAGAATGAACAAGGGGAACAAGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
1063274325 10:4548459-4548481 GAGAATGAACAAAGGGTTCAAGG + Intergenic
1063296240 10:4809672-4809694 CGGGATGAACAGACAGATGAAGG + Intronic
1063767160 10:9155472-9155494 CAGAATGATGAGAGAGATCAAGG + Intergenic
1064458968 10:15514874-15514896 CAGAATGAAGCAAGGCATGAGGG - Exonic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068119340 10:52770521-52770543 AAGAATGAAGAGAGGGCTGAGGG + Intronic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071710403 10:88043798-88043820 CAGAATGAACATAGATAGGAAGG - Intergenic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1078114477 11:8431920-8431942 CAAAATGACCAGAGGTATGGAGG - Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084784926 11:71436801-71436823 CAGAATCAATAGAGGGGTGGAGG - Intronic
1085202353 11:74709195-74709217 GAGAATGAACAGAGGAATCCTGG + Intronic
1085847507 11:80083194-80083216 AAGAAGGAAGAGAGGGAGGACGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1087000004 11:93408414-93408436 CAAAATGAAGAGAGGTATGCTGG + Exonic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087610775 11:100431895-100431917 CAGAAGCAAAAGTGGGATGAGGG + Intergenic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087983097 11:104641693-104641715 CAGAATGAATTGAGGCTTGAAGG - Intergenic
1089396310 11:118138143-118138165 CAGAAAGCTCAGAGGGATGCAGG - Intronic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089768180 11:120783686-120783708 CAAAATGCATAGAGGGACGAGGG - Intronic
1089851191 11:121498027-121498049 CAGAATGAGAAGAGAGATGTGGG + Intronic
1090051665 11:123385480-123385502 AAGAAAGAACAAAGGTATGAAGG - Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1092073554 12:5653874-5653896 CGGGATGAAAAGGGGGATGAGGG + Intronic
1092708565 12:11309989-11310011 CAGTAAGTACACAGGGATGATGG - Intronic
1092712777 12:11355144-11355166 CAGTAAGTACACAGGGATGATGG - Intronic
1092716575 12:11395120-11395142 CAGTAAGTACACAGGGATGATGG - Intronic
1092867771 12:12779068-12779090 CAGAATGGACAAAGGAATGGAGG - Intronic
1093643468 12:21555001-21555023 CAGACAGAAGGGAGGGATGAGGG - Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096182605 12:49558980-49559002 CAGAAAGAAAGAAGGGATGATGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1099310549 12:81015937-81015959 CATAATGAAAAGCGGTATGAAGG - Intronic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1101047985 12:100830565-100830587 CTGTAAGAACAGAGGGCTGATGG - Intronic
1101721733 12:107356310-107356332 CAGAATGAACGGAGTTATCAAGG + Intronic
1102243473 12:111340252-111340274 CAGAATGAAAGAAGGTATGAGGG - Intronic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1105290028 13:19047749-19047771 TAGAATGAACAGTGGGCTGCGGG - Intergenic
1105427988 13:20312313-20312335 CAGAATGAAGAGATGCATGTGGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106696001 13:32173132-32173154 CAGAAGTAACAGATGGTTGATGG + Intronic
1106900575 13:34351215-34351237 AGGAATGAGTAGAGGGATGATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107571443 13:41663309-41663331 CAGATGGAAAAGAGGAATGAGGG - Intronic
1108334400 13:49424160-49424182 CAGCATGAAAAGAGGGGTAATGG + Intronic
1108729510 13:53219975-53219997 CAGAAAGAAGAAAGGGGTGATGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110696864 13:78501292-78501314 CAGAATAAACCCAGGTATGAAGG + Intergenic
1111806597 13:93045843-93045865 CAGAATAAAGAATGGGATGAGGG + Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113663049 13:112120145-112120167 AAGAAGGAAGAGAGGAATGAGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1115212936 14:30985933-30985955 GAGAATGAAAAGAGAGCTGAGGG - Intronic
1115348338 14:32366201-32366223 CAGGATGAACAGGGGAATTATGG - Intronic
1115418586 14:33166151-33166173 CAAATTGAACCGAGGGGTGAGGG - Intronic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1118991929 14:70804903-70804925 CAGAAAGAAGGGAGGGAGGAAGG + Intronic
1119129424 14:72157815-72157837 AAGAATGAACAAAGGAATGGTGG - Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1120287128 14:82518120-82518142 AGGAAGGAAGAGAGGGATGAAGG + Intergenic
1120499061 14:85271349-85271371 CAGAAGGAACAGAGAGATGGTGG + Intergenic
1120943743 14:89974447-89974469 CAGAATGCACAGATGCATGCTGG + Intronic
1121332133 14:93056251-93056273 CAGAAAGATCACAGGGAGGACGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121681295 14:95794814-95794836 CAGAATGCACTGAGGGATCAAGG + Intergenic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1124558005 15:30745824-30745846 CACACTGAACACAGGGATAAGGG - Intronic
1124673236 15:31659820-31659842 CACACTGAACACAGGGATAAGGG + Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1125273167 15:37962552-37962574 CAGAATGAATTGGGGGATGGGGG + Intronic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126469998 15:48999132-48999154 CAGAATGGACAGGGGAATGTAGG + Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127185943 15:56480891-56480913 AAGAATGGTCAGAGGGAAGAGGG - Intergenic
1128574969 15:68767552-68767574 CTGATTGAAAAGAGGCATGAGGG - Intergenic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130012499 15:80162586-80162608 CAGAAGGAGCATAGGGATTAAGG - Intronic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131916728 15:97274097-97274119 CAGAATATCCAGAGGGATCACGG - Intergenic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134136036 16:11676952-11676974 CAGAAAGAACGGAGGGGTGCGGG - Exonic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1137474890 16:48799124-48799146 CAGAAAGAGGACAGGGATGAGGG + Intergenic
1137873952 16:51977471-51977493 AAGAATGAACAGAATGGTGATGG - Intergenic
1138130636 16:54476763-54476785 GAGACTGAATAGAGGAATGATGG + Intergenic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139662509 16:68430644-68430666 TATAATGAACAGTGGGGTGATGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140194417 16:72845018-72845040 GAGAATGAACAGGTGCATGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1144406662 17:14958618-14958640 CAGAATAAATAGGGGGATGTAGG - Intergenic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146175452 17:30663465-30663487 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1146348903 17:32079511-32079533 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147817228 17:43218854-43218876 CAGAAAGGACAGAGGGCTAAAGG - Exonic
1147953675 17:44120905-44120927 CAGAAGGATCAGAGCCATGAAGG + Intronic
1148384725 17:47226022-47226044 AAGAAAGAAGAGAGGGAGGAGGG - Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1148828384 17:50411977-50411999 TGGAATGAACAGAGGGGAGAAGG - Intergenic
1149128298 17:53262849-53262871 AAGAAAGAAAAGAGGGATGGCGG + Intergenic
1150190753 17:63235465-63235487 AAGAATTAAAAGAGAGATGAGGG - Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1154062919 18:11080506-11080528 CAGAATGAATAAAGGAATAAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156442699 18:37207598-37207620 CAGAATGCTCAGAGGTATGAGGG + Intronic
1157434443 18:47656570-47656592 CAGCATGAACAGAGGCTTGTGGG + Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158258729 18:55585536-55585558 AAGAAAGAACAGAGTGATAATGG - Intronic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1158475456 18:57775436-57775458 AAGAAGGAAGAGAGGGAGGAAGG + Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159472025 18:68869199-68869221 AACAATGAGCAGAGAGATGATGG + Intronic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162983519 19:14254446-14254468 CAGAAGGAAAAGAAGGTTGAGGG + Intergenic
1163050210 19:14677510-14677532 GAGAATGGCCAGAGAGATGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164969555 19:32519772-32519794 CAGAATGCACAGTAGGATGCAGG - Intergenic
1164969745 19:32521497-32521519 CAGAATGCACAGTAGGATGCAGG - Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165733911 19:38163905-38163927 GGGAATAAACAGGGGGATGAGGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1167024228 19:46903210-46903232 CAGAATGAAGAGAGGGTTTGGGG - Intergenic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
925435411 2:3833113-3833135 AAGAATGCTCAGAGGGATGCAGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926075675 2:9941028-9941050 CAGAATGATCTGAGGGGTGCAGG - Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927503765 2:23599951-23599973 CAGAATGAAAAGGGGGATGGGGG - Intronic
928436407 2:31257327-31257349 AAGGATGGACAGAGGGATGTAGG + Intronic
929568037 2:43001915-43001937 CACAATGAACAGTGGAATGGGGG + Intergenic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930559068 2:52937557-52937579 CTGAATTAACATAGGGTTGAAGG - Intergenic
931336935 2:61354968-61354990 CAGCAACAACAGAGGGATGTGGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932099264 2:68882017-68882039 CTGAAGGATCAAAGGGATGATGG + Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933654385 2:84875597-84875619 TGGGATGAATAGAGGGATGAGGG + Intronic
934019677 2:87933888-87933910 CAGAATGTGGAGAGGAATGAAGG - Intergenic
934042588 2:88141010-88141032 AAGAAAGAAAAGAGGGAGGAGGG - Intergenic
934560719 2:95311954-95311976 CAGAATGAACAGTGCCCTGAAGG - Intronic
934993832 2:98939379-98939401 GAGAAGGATCAGAGGGATGGTGG - Intergenic
935100283 2:99988111-99988133 AAGAAGGAACAAAGGGATGAAGG + Intronic
935542132 2:104361118-104361140 TGGAATGAACAGGAGGATGAAGG + Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937545587 2:123014686-123014708 CAAGATGAAAAGAGCGATGAAGG + Intergenic
938608276 2:132919564-132919586 CAAGATCAACAGCGGGATGATGG + Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939060477 2:137415756-137415778 CTGAATGAAAGGAGAGATGAAGG - Intronic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
942369612 2:175268922-175268944 AAGAAGGAAAGGAGGGATGAAGG - Intergenic
942644265 2:178094048-178094070 CAGAAGGAAAATAAGGATGATGG - Intronic
942911617 2:181251274-181251296 CTGAATGAAGAGAGGAATGCAGG + Intergenic
944107688 2:196097134-196097156 CAGCATGAACTCAGGTATGATGG - Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944566334 2:200995355-200995377 CAGAAAGATCATAGGGATCATGG - Intronic
945096786 2:206228030-206228052 GAGAATGAAAGGAGAGATGAGGG + Intergenic
947227085 2:227851023-227851045 CATAATGAAAGGAAGGATGAAGG - Intergenic
947279573 2:228434985-228435007 CAGAATGAACAGGTTGATGAAGG - Intergenic
947391144 2:229640901-229640923 CAGAATGTCCAAAGGGGTGAGGG + Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948362134 2:237429754-237429776 CAGAATAAAGACAGGGTTGAAGG + Intergenic
948484992 2:238274817-238274839 CAAAATGGACAGTGGGATTAGGG + Intronic
1169006535 20:2212027-2212049 TAGAATGAACAGACGGCTGAAGG + Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170056242 20:12207390-12207412 CAGAAAGAAAAGAGAGATTAAGG - Intergenic
1170352491 20:15457362-15457384 CAGAAAGAACAAGGAGATGATGG - Intronic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1171235797 20:23523669-23523691 CAAAATGCAAAGAGGGAAGAGGG + Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173418175 20:42877110-42877132 CATAATGAACAGAAAGCTGAAGG + Intronic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175495145 20:59409205-59409227 CAGAATGAATCAAGGGAGGAAGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177612165 21:23465926-23465948 CATAATGTCCAGAGGGATGCTGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1179196718 21:39171058-39171080 CAGAAACTACAGATGGATGATGG + Intergenic
1179413808 21:41181970-41181992 CAGAATTAACAGTGGCATCATGG + Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1180109116 21:45639756-45639778 TAGAATGAACACAGAGAGGATGG - Intergenic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181824852 22:25506867-25506889 CAGAATGAAGAGCCGGATGTAGG - Intergenic
1182030968 22:27159174-27159196 GCGAGTGAACAGAGGGGTGAGGG + Intergenic
1182541543 22:31045632-31045654 TTGAAGGAACTGAGGGATGAGGG - Intergenic
1182996149 22:34814260-34814282 CCCACTGAACAGAGGGATAAAGG - Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183997759 22:41648330-41648352 CAGCATGTACTGAGTGATGAAGG - Intronic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1184303779 22:43580364-43580386 GAGAATGAACAGAGGTGGGAGGG + Intronic
1184869405 22:47225824-47225846 GAGAAAGGACAGAGAGATGATGG - Intergenic
1184902181 22:47453316-47453338 CAGGAAGAAGGGAGGGATGAGGG - Intergenic
1185151611 22:49167130-49167152 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
949573262 3:5313634-5313656 AAGAATGAACAAGGTGATGAGGG + Intergenic
950020896 3:9787055-9787077 CAGCATGAACAGCCGGAAGATGG - Exonic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
952977911 3:38711674-38711696 CTGAATGAACAGGTAGATGAAGG + Intronic
953167031 3:40474638-40474660 GAGGAGGAACAGGGGGATGAGGG + Intergenic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955991675 3:64634356-64634378 CAGAATGAATGGAGGTGTGAGGG - Intronic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957336330 3:78833795-78833817 CAGAAAGAACTGAGGGGTGAGGG + Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
963547287 3:146676159-146676181 CAGATTCAACAGAGGGACTATGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965367155 3:167815029-167815051 CAGAATGCAAAGGGGTATGAAGG - Intronic
965743793 3:171904084-171904106 CAGAAGGAAAAGAGAGATGGGGG + Intronic
966047620 3:175571910-175571932 CAAAATGAACACAGGTTTGAAGG + Intronic
966630135 3:182063506-182063528 AAGAAGGAACAGAGGAAGGAGGG + Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969587368 4:8102154-8102176 CAGAATGACCAAGGGGATTAGGG - Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
973865034 4:55104107-55104129 CTGCATGAAGAGTGGGATGATGG - Intronic
975742597 4:77443852-77443874 CATAGTGAACTGAGGGATGTTGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
977134036 4:93279716-93279738 CAGAATGAACAGAGTTATTATGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979588287 4:122446706-122446728 AAGAATGAAGAGAGGAATAAAGG - Intergenic
980861789 4:138507785-138507807 CAGAAAGAGCAAAGGCATGAGGG + Intergenic
981842295 4:149126612-149126634 CAGAAGGGAGGGAGGGATGAAGG + Intergenic
982291127 4:153783776-153783798 CACAAAGAACAGAGGCAAGATGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982618746 4:157677340-157677362 CAGGAGGAAGAGAGAGATGAGGG + Intergenic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984536215 4:180978965-180978987 TAGAATGGATTGAGGGATGAGGG - Intergenic
984949307 4:184994875-184994897 CACAAAGAGCAGGGGGATGACGG + Intergenic
985422827 4:189801654-189801676 CAGAAGGGACACAGGGATGATGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
987160303 5:15134642-15134664 CAGAAAGTACAGAGGGTTGGGGG - Intergenic
987562145 5:19538352-19538374 TAGATTGCACAGAGGGAAGATGG + Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989812093 5:45690507-45690529 TAGAATTAACAGAGCCATGAAGG + Intronic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991908076 5:71531982-71532004 CAGACTGAACAGAGAAATTAGGG + Intronic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
993127591 5:83854683-83854705 CACAATGAAAAGAGAAATGAAGG + Intergenic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994654123 5:102568299-102568321 CCGAATGACCAGTGGGATAATGG - Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995031539 5:107487308-107487330 CAGAATGCACAAAGTGCTGAGGG - Intronic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996672623 5:126135662-126135684 CAGAAGGAACAGAGCCATGAGGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997602905 5:135152510-135152532 TAGGATGGACAGAGGGATCATGG - Intronic
998590894 5:143477052-143477074 TAGAATGAACTGAGATATGAAGG + Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999776555 5:154816749-154816771 TAGGATGAACAGAGGGATCTGGG - Exonic
1000186119 5:158859690-158859712 CAGTATGCACAGAGGCTTGAAGG - Intronic
1000443047 5:161285679-161285701 CAGAATGGTCAGAGAGATGCTGG - Intergenic
1001121657 5:168985817-168985839 GAGAAGGAAAGGAGGGATGATGG + Intronic
1001441795 5:171749383-171749405 GAGAATGAGCAGAGGCTTGATGG - Intergenic
1002598469 5:180339656-180339678 ATGAAAGGACAGAGGGATGATGG - Intronic
1002641936 5:180634713-180634735 AAGAATGGTCAGATGGATGATGG + Intronic
1004604075 6:17177326-17177348 AAGAAGGAACAAAGGGAAGAAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005415582 6:25597140-25597162 CAAAAAGAAAGGAGGGATGAAGG + Intronic
1006324023 6:33339668-33339690 CAGACTGAAAATGGGGATGAGGG + Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007156454 6:39749721-39749743 CAGAAAGGACAGAGGGGTCAAGG + Intergenic
1007814929 6:44514963-44514985 AAGAAAGAAGGGAGGGATGAGGG + Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1010763535 6:79751796-79751818 AAGAAAGCCCAGAGGGATGAGGG + Intergenic
1011255557 6:85417267-85417289 GAGAAAGAACAGAGGGAGAAGGG + Intergenic
1011847461 6:91584199-91584221 AAGAAGGAAGAGAGGGAGGAAGG + Intergenic
1011957102 6:93037155-93037177 CAGAATGTACAGGGGCAAGATGG + Intergenic
1012172937 6:96042097-96042119 CAGGATGAACCTAGGGATGTCGG - Intronic
1013807658 6:114012893-114012915 CAGACTGTATAGAGGTATGAAGG + Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015731968 6:136358171-136358193 AAGAATGAACAAAGGCAAGAGGG - Intronic
1017112304 6:150943807-150943829 CAGAATGAGTAGAGTCATGAGGG + Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018036898 6:159889454-159889476 CCGAAGGAAATGAGGGATGAAGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018657125 6:166048052-166048074 CAGAATGAAAAGTGATATGAGGG - Intergenic
1018803426 6:167240581-167240603 AGAAATGAACAGAGTGATGAAGG + Intergenic
1018806752 6:167267852-167267874 AGAAATGAACAGAGTGATGAAGG - Intergenic
1019332415 7:466889-466911 CTCAATGGAAAGAGGGATGATGG - Intergenic
1019952837 7:4387729-4387751 CAGATTGAACAGAGGGCTAAAGG + Intergenic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1020758673 7:12240194-12240216 CAGAATGAGCGAAGGGATAAAGG - Exonic
1021184207 7:17543905-17543927 GAGAAAGTGCAGAGGGATGAAGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021981474 7:26059578-26059600 TTGAATGGACACAGGGATGAGGG - Intergenic
1023586848 7:41739726-41739748 GAGAATGAACAGTGGGCTAATGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025968847 7:66302982-66303004 CAGAAGGAACAAAGGTATGGAGG - Intronic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1026766098 7:73160801-73160823 CAGAAAGAACAAAGGCCTGAAGG - Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1027042573 7:74970497-74970519 CAGAAAGAACAAAGGCCTGAAGG - Intronic
1027081070 7:75231860-75231882 CAGAAAGAACAAAGGCCTGAAGG + Intergenic
1027615415 7:80417391-80417413 CAGAATGAACCGATGTCTGAAGG + Intronic
1027622351 7:80505034-80505056 AAGAATTTACAGAGGGATCAGGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028492622 7:91429837-91429859 CAGAATGAAAAGAGAAGTGATGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1028959768 7:96735574-96735596 CAGGATGAACAGGTAGATGATGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029178859 7:98685022-98685044 CAGAAGGAAGACAGCGATGATGG + Intergenic
1030639402 7:111987282-111987304 CAGAATGAAAAGGGGAAGGAAGG - Intronic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1036428618 8:8669127-8669149 CAAAATGAACAGAGGGTTGGTGG - Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1036984185 8:13508365-13508387 CAGAATTAACAGAGCCATGTGGG + Intronic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037414456 8:18634548-18634570 CAGAATGCACTGTGGGATCATGG - Intronic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038441121 8:27571546-27571568 CACGATCAACAGAGGCATGAGGG - Intergenic
1038672052 8:29590550-29590572 AAGGACGAACAGAGGGATTAAGG + Intergenic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039567287 8:38560439-38560461 GAGAATGCACAGGGGGATGCGGG - Intergenic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044934091 8:97277270-97277292 AAGAAGGAAGAGAGGGATGCAGG - Exonic
1045200763 8:99978479-99978501 AAGAAAGAAAAGAGGGAGGAGGG - Intronic
1045910060 8:107396991-107397013 CAGAAAGAAGAAAGGGATGCTGG + Intronic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046461332 8:114541378-114541400 CATAATCAAAAGAGGCATGAAGG + Intergenic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048053956 8:130846487-130846509 AAGAAGGAAGAGAGGGAGGAAGG - Intronic
1048405105 8:134111014-134111036 TAATATGAACAGATGGATGAAGG - Intergenic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1048793727 8:138129240-138129262 CAGAATGAGCAGAGGGCTTCAGG - Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049582910 8:143420887-143420909 CAGCAGGAACAGAAGGGTGAGGG + Intronic
1050225331 9:3448442-3448464 CAGAATGGACAGAGGACTCATGG - Intronic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1054754471 9:68943360-68943382 CATAAGGAAAAGAGGCATGAAGG + Intronic
1055111382 9:72563440-72563462 CAGAATGAACACAGTGACCATGG + Intronic
1057852284 9:98574950-98574972 CTCAATGATCAGAGGGATGGAGG - Intronic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1187670916 X:21665144-21665166 CTGAAAGACCAGAGGGGTGAAGG - Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188809303 X:34633250-34633272 CAGACAGAACACAGGGATGAGGG + Intronic
1188849451 X:35114065-35114087 CAAAATGAATAGAATGATGATGG + Intergenic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189412274 X:40783134-40783156 CAGAAGGCACAGAGAGATGCAGG - Intergenic
1190093938 X:47463821-47463843 TAGAATGGGCAGAGGGATCAGGG - Intronic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1192298667 X:69878008-69878030 CAGAATGAACACATAGATCAAGG - Intronic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1196232847 X:113244396-113244418 CAGAATGGGCATAGGAATGAGGG - Intergenic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198033682 X:132780322-132780344 CAGGATGAAGGGAGGCATGAGGG - Intronic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1198704165 X:139429423-139429445 AACAATAAACAGAGTGATGATGG - Intergenic
1198706365 X:139452860-139452882 GAGAATGAAAAGAGAGATGATGG + Intergenic
1199024770 X:142923422-142923444 CAGCATGACAAGAAGGATGAAGG - Intergenic
1199051363 X:143240340-143240362 CAGAATGAACAACTGGATGGGGG - Intergenic
1199124850 X:144105247-144105269 CAGAATGTGGAGAGGAATGAAGG + Intergenic