ID: 1096900195

View in Genome Browser
Species Human (GRCh38)
Location 12:54869481-54869503
Sequence CTTTAGCTCTCATGTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096900192_1096900195 27 Left 1096900192 12:54869431-54869453 CCAGCTCACAGATTTGTTAACAC No data
Right 1096900195 12:54869481-54869503 CTTTAGCTCTCATGTGCAATAGG No data
1096900191_1096900195 28 Left 1096900191 12:54869430-54869452 CCCAGCTCACAGATTTGTTAACA No data
Right 1096900195 12:54869481-54869503 CTTTAGCTCTCATGTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096900195 Original CRISPR CTTTAGCTCTCATGTGCAAT AGG Intergenic
No off target data available for this crispr