ID: 1096906431

View in Genome Browser
Species Human (GRCh38)
Location 12:54941079-54941101
Sequence GTGGAATACGGCAGTGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096906431_1096906436 -7 Left 1096906431 12:54941079-54941101 CCGTCCCCACTGCCGTATTCCAC No data
Right 1096906436 12:54941095-54941117 ATTCCACCCAGTAGCCTCAGAGG No data
1096906431_1096906441 10 Left 1096906431 12:54941079-54941101 CCGTCCCCACTGCCGTATTCCAC No data
Right 1096906441 12:54941112-54941134 CAGAGGCCTCTCTGTAGCTCAGG No data
1096906431_1096906443 28 Left 1096906431 12:54941079-54941101 CCGTCCCCACTGCCGTATTCCAC No data
Right 1096906443 12:54941130-54941152 TCAGGAAAGTGATCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096906431 Original CRISPR GTGGAATACGGCAGTGGGGA CGG (reversed) Intergenic
No off target data available for this crispr