ID: 1096909081

View in Genome Browser
Species Human (GRCh38)
Location 12:54963815-54963837
Sequence GCCCTTGGCCTGAGAGGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096909072_1096909081 16 Left 1096909072 12:54963776-54963798 CCTCCGCACCTGGGACTTCAGGA 0: 1
1: 0
2: 0
3: 55
4: 1855
Right 1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG 0: 1
1: 0
2: 5
3: 34
4: 345
1096909073_1096909081 13 Left 1096909073 12:54963779-54963801 CCGCACCTGGGACTTCAGGAAGA 0: 1
1: 0
2: 2
3: 37
4: 303
Right 1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG 0: 1
1: 0
2: 5
3: 34
4: 345
1096909074_1096909081 8 Left 1096909074 12:54963784-54963806 CCTGGGACTTCAGGAAGAGCTGG 0: 1
1: 0
2: 5
3: 39
4: 376
Right 1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG 0: 1
1: 0
2: 5
3: 34
4: 345
1096909068_1096909081 26 Left 1096909068 12:54963766-54963788 CCATTTCAATCCTCCGCACCTGG 0: 1
1: 0
2: 0
3: 23
4: 115
Right 1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG 0: 1
1: 0
2: 5
3: 34
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096909081 Original CRISPR GCCCTTGGCCTGAGAGGGGG TGG Exonic
900116092 1:1028522-1028544 GCCCTTGGCCCATGAGGGGCTGG - Intronic
900116112 1:1028583-1028605 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116133 1:1028644-1028666 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116154 1:1028705-1028727 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116175 1:1028766-1028788 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116196 1:1028827-1028849 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116216 1:1028888-1028910 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116237 1:1028949-1028971 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116258 1:1029010-1029032 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900116280 1:1029071-1029093 GCCCTTGGCCCACGAGGGGCTGG - Intronic
900353533 1:2248573-2248595 GCCTTTGACCTGAGGCGGGGCGG + Intronic
901018037 1:6242704-6242726 TGCCTCGGCCTGAAAGGGGGAGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901512970 1:9727059-9727081 GCCCTGGGCCCAAGAGGAGGCGG + Exonic
901606773 1:10465348-10465370 TCACTTGACCTGGGAGGGGGAGG - Intronic
901805501 1:11736190-11736212 GCCCTCGGCCTGAGTCGGGATGG + Exonic
902324252 1:15688564-15688586 GCACTTGACCTGGGAGGTGGAGG + Intronic
903833779 1:26189955-26189977 GCTCTTGGCCAGAGGGTGGGTGG + Intergenic
904028911 1:27521739-27521761 TCCCTTGGCCGGCGAGGGTGGGG - Intergenic
904259515 1:29280319-29280341 ACCCATGGCCTCAGAGGGGAGGG - Intronic
904674127 1:32187834-32187856 GCTCCTGGCCTGAGAGGGTAAGG + Intronic
904944521 1:34189605-34189627 GGCCTTGGCCTGAGCCAGGGTGG + Intronic
905818655 1:40972048-40972070 GAACTTGGCCTGGGAGGTGGAGG + Intergenic
905923560 1:41734438-41734460 ACCCTGGGCATGGGAGGGGGTGG - Intronic
906535834 1:46550512-46550534 GCCTTTGGCCTGGGCGGGGGCGG + Intronic
907304793 1:53507465-53507487 GCCCTTGACTTGGGAGGGGCCGG + Intronic
907410638 1:54281138-54281160 GCCCCTGGCCAGGGAGGTGGTGG - Intronic
907425159 1:54374917-54374939 GCCAGGGGCCAGAGAGGGGGAGG + Intronic
907819571 1:57953886-57953908 TCCCTTGGCCTGAAAGGGAAAGG - Intronic
909354322 1:74690134-74690156 GCACTGGGACTGATAGGGGGAGG + Intergenic
912459645 1:109822207-109822229 GCCCTTGGCTCAAGAGAGGGAGG + Intergenic
912474230 1:109925408-109925430 GTCCCTGGCCTCAGCGGGGGTGG - Intronic
914900705 1:151709688-151709710 GCCCTGGGCCTGGGGGTGGGAGG + Intronic
915238587 1:154502936-154502958 GCCCCCGGGCTCAGAGGGGGCGG + Intronic
915585245 1:156840765-156840787 TCCCTTGCCCTGAGTTGGGGTGG + Exonic
916588298 1:166166606-166166628 GCCCCTCGCCGGAGAGGAGGAGG + Exonic
918406216 1:184214044-184214066 GCTCTGGGCCTGAGGAGGGGAGG - Intergenic
919414845 1:197295250-197295272 GCCCAAGGCCTGAGTGAGGGTGG + Intronic
920007366 1:202843264-202843286 GCCCCTGGCGTGAGCAGGGGAGG + Intergenic
920312396 1:205056395-205056417 GCCCCAGGCCTCAGAGGCGGAGG - Intronic
920370936 1:205478944-205478966 GCCCTTGGCATGGGAGGGCAGGG + Intergenic
921152607 1:212414264-212414286 GGCCTTGGGCTTGGAGGGGGAGG + Intronic
922162444 1:223088569-223088591 GCCCTTGGCTTTGGATGGGGAGG - Intergenic
922487414 1:225985408-225985430 GCCCTTGGACTGAAATGTGGGGG - Exonic
922798147 1:228351646-228351668 GCCCCCGGCCTGTGATGGGGGGG - Intronic
923085266 1:230698429-230698451 GCCCATTCCCTGAGAGGAGGCGG + Intergenic
924514918 1:244757905-244757927 TCCTCTGGCCTGAGAGGAGGGGG - Intergenic
1063338870 10:5244285-5244307 GCCCTGGGGCTGAGAGCAGGAGG + Intergenic
1065529378 10:26653188-26653210 GCCCTTGGCCTTGGGGGGTGTGG - Intergenic
1066649405 10:37640433-37640455 GCCCTGGCCCAGGGAGGGGGCGG + Intergenic
1067032291 10:42885974-42885996 GCCCTGGCCCAGGGAGGGGGCGG + Intergenic
1067346636 10:45442902-45442924 GCCCTTGTCCTGTGAGATGGGGG - Intronic
1067431970 10:46251084-46251106 GCCCTGAGCCTGGGATGGGGTGG - Intergenic
1067441449 10:46311118-46311140 GCCCTGGGCCTGGGATGGGGTGG + Intronic
1067578152 10:47420567-47420589 GCCCTGGGCCTGGGATGGGGTGG + Intergenic
1069894525 10:71672329-71672351 GCCCTGGGCCTGGGAGGAGGCGG - Intronic
1069983856 10:72270783-72270805 CACCTTGGCCTGAGGGGAGGAGG + Intergenic
1069989523 10:72306330-72306352 CCCCTGGCCCTGAGAGGGAGTGG + Intergenic
1070581296 10:77722001-77722023 GCATTTGGCCTGAGGTGGGGTGG + Intergenic
1071799386 10:89042335-89042357 GCCATGGGCCTGAGTGGTGGTGG - Intergenic
1072685531 10:97534297-97534319 GCCCTGGGACTGAGATGGGGAGG + Intronic
1073000760 10:100284573-100284595 TCGCTTGACCTGAGAGGTGGAGG - Intronic
1073107294 10:101039426-101039448 TCCCTGGGCCTGAGTGGGGTTGG + Intronic
1073208566 10:101781223-101781245 GCCCTGGGCCTGGGGGAGGGTGG - Intergenic
1074191913 10:111145578-111145600 GCACATGGACTGAGAGTGGGAGG + Intergenic
1076361408 10:129892024-129892046 GCCGTTGGCCAGAGAGAGGCGGG - Intronic
1076546397 10:131248535-131248557 TCCATTGGCCTGCGTGGGGGAGG - Intronic
1076577049 10:131476263-131476285 GCCTTGGGACTGACAGGGGGAGG - Intergenic
1076605783 10:131689148-131689170 GCACTTTGCCTGGGAGGTGGGGG - Intergenic
1076827548 10:132976937-132976959 CCCACTGGCCTGAGACGGGGAGG - Intergenic
1076885904 10:133262146-133262168 GCCATTGCCCGGAGACGGGGCGG + Intergenic
1077060058 11:614029-614051 GCCCTGGGCCTGAGGAGGGGAGG + Exonic
1077119679 11:901115-901137 GCCCTGGGCCAGGGAGGGGTGGG - Intronic
1077120452 11:905122-905144 GGCCTTGGGCTGTGAGGGGAGGG - Intronic
1077242174 11:1516397-1516419 GCCCTGGGGCTGATAGGAGGGGG - Intergenic
1077368708 11:2171748-2171770 GCCCTTGGCCTGTGGCGTGGTGG + Exonic
1078191882 11:9097795-9097817 GCCTTTAGCCTGATAGGGAGTGG - Intronic
1080011404 11:27463166-27463188 GCCCTTAGCCTGGGAGGTTGAGG + Intronic
1080874971 11:36266654-36266676 GCCCTGGGCCTGAGCAGAGGTGG - Intergenic
1082106222 11:48224615-48224637 GCCCTTGGACTTTGAGTGGGGGG + Intergenic
1083197952 11:61102264-61102286 GGCCTTGTCCTGTGTGGGGGTGG + Intergenic
1084476113 11:69390695-69390717 GACCTTGGACAGAGAGGGGAGGG + Intergenic
1084515820 11:69637547-69637569 CCACTTGGTCTGAGAGGGGCTGG + Intergenic
1084709047 11:70832718-70832740 GCCCTGGGCAGAAGAGGGGGTGG - Intronic
1084758416 11:71252851-71252873 GGCTTTGGCCAGGGAGGGGGAGG - Intergenic
1087182259 11:95151810-95151832 GCCCAGTGCCTGAGACGGGGAGG - Intergenic
1087877429 11:103374980-103375002 GCCCCTGGCCTGTGAAGGGAGGG - Intronic
1090282149 11:125465479-125465501 GCTTTGCGCCTGAGAGGGGGAGG - Intronic
1092087387 12:5774380-5774402 GCCTTGAGCCTGAGATGGGGAGG + Intronic
1092861709 12:12724802-12724824 CCCTTTTGGCTGAGAGGGGGTGG - Intergenic
1093041119 12:14380702-14380724 TCCCTTGGCCTGGGAGGCAGAGG - Intronic
1094191111 12:27699556-27699578 GACAATGGCCTGAGAGGGGAAGG - Intergenic
1096489376 12:52005468-52005490 GCTCTTGGCCTGGTAGGGAGTGG - Intergenic
1096519170 12:52174451-52174473 TCCCTTGGCTAGAGAGGGAGTGG - Intronic
1096625898 12:52895894-52895916 GCCCTGGGGCTGAGTGGGAGGGG + Intergenic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1097020940 12:56020619-56020641 GGCCTTGTCCTGATAGAGGGCGG + Intronic
1097166946 12:57091111-57091133 GCACTGGGCCTGAGAAGGAGGGG - Exonic
1097196053 12:57243022-57243044 ACCCTGGGCCTGGGAGGGGGTGG - Intergenic
1097626851 12:62010953-62010975 GCCCTTCGTCTGGGAGGTGGGGG + Intronic
1101675469 12:106913111-106913133 GACCTGGGCCTCAGAAGGGGTGG + Intergenic
1101834985 12:108288815-108288837 GCCCTTGGAAGGAGAGGGTGGGG - Exonic
1101844212 12:108349542-108349564 GCCCTGGGCCTGGGTGGGTGAGG + Intergenic
1102562951 12:113775846-113775868 GCCCTTGGCCTCAGGGATGGGGG - Intergenic
1103336964 12:120196926-120196948 GGCCTTGACCTGAAAGGAGGGGG + Exonic
1103746894 12:123130971-123130993 GCCCTAGGCATGTGAGGGTGGGG - Intronic
1104662302 12:130620165-130620187 TCCCTTGGCTGGAGAGGGTGAGG - Intronic
1104680315 12:130746618-130746640 GCTGCTGGCCTGACAGGGGGCGG + Intergenic
1104877384 12:132045086-132045108 GCACATGGCCTGAGAGGCAGCGG - Intronic
1106129260 13:26926067-26926089 GGGCTTGGGCTGAGAGGGAGAGG - Intergenic
1106413326 13:29525917-29525939 GCCTCTGGCCTGAGAGGCGAGGG - Intronic
1107640978 13:42442985-42443007 GAACTATGCCTGAGAGGGGGTGG - Intergenic
1112922240 13:104628074-104628096 CCCCTTGGTCTGACAGGAGGTGG - Intergenic
1113800758 13:113085266-113085288 GCCCTTGGCCTGGGAGGGGCAGG - Intronic
1118220886 14:63853509-63853531 GGCCTGGGCCCGGGAGGGGGCGG - Intronic
1118983654 14:70735115-70735137 GCCCTTGGTCTGTCTGGGGGTGG + Intronic
1119130563 14:72168784-72168806 CCCCTTGCCCTGTGAGGAGGAGG + Intronic
1119330001 14:73786830-73786852 GCCGTTGGCCTGAGGTAGGGTGG - Intronic
1119773153 14:77234041-77234063 GTTCTTGGCCTGTGAGGGGAAGG - Intronic
1121274431 14:92657914-92657936 GCCCTAGCCCTGAGAGAGGAGGG - Intronic
1122072765 14:99215157-99215179 TCCCTTGGCCGGAGCAGGGGTGG - Intronic
1123116854 14:105898823-105898845 GGGCTTGGCCTGAGAGGGGGCGG + Intergenic
1123505624 15:20939886-20939908 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1123599104 15:21950877-21950899 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1124258815 15:28167990-28168012 GTCCTAGGCCTGACTGGGGGTGG - Intronic
1126299893 15:47184060-47184082 GCACGTGGGCTGAGTGGGGGTGG + Intergenic
1126543276 15:49844931-49844953 GTCCTTGGCCTGTGAGTGTGTGG - Intergenic
1128082623 15:64865473-64865495 GCCCTCAGCCTGAGAGGGCTTGG - Exonic
1128323169 15:66706478-66706500 GCCCCTGGCCTGAGAGCTGGGGG + Intronic
1129365051 15:75049037-75049059 GCCCAAGGCCTGAGAGGGCAAGG - Intronic
1202971210 15_KI270727v1_random:240727-240749 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1132464151 16:69999-70021 GCACTTGGCAGGAGGGGGGGGGG + Intronic
1132664943 16:1077270-1077292 GACCTCGGCCTGAGCAGGGGTGG - Intergenic
1132722539 16:1323810-1323832 GCCCTTGGCGTGGGTGGGGGTGG + Intronic
1132752646 16:1465876-1465898 GCCCCTGCCCTGAGCTGGGGCGG - Intronic
1132802870 16:1762862-1762884 GCGCTTGGCCGGAGGGGGGCTGG - Exonic
1134474674 16:14562372-14562394 CCCCTGAGCCTGAGAGGTGGAGG + Intronic
1134902091 16:17947664-17947686 GACCTTGGGCTGAGAGAGGAAGG - Intergenic
1137284491 16:47003757-47003779 GCGCTTGACCTGGGAGGTGGAGG + Intergenic
1137722407 16:50635160-50635182 CCCCTGGGCCTGAGTGGGGAAGG + Exonic
1138194286 16:55040953-55040975 GCCCTGGGAATGAGAGGGGCGGG - Intergenic
1138554514 16:57763835-57763857 GCCCTGGTCCTGAGAGAGGTCGG + Intronic
1139390527 16:66604571-66604593 GCCCCAGGCCGGGGAGGGGGCGG + Intronic
1139615328 16:68085262-68085284 GCGATAGGCCTGTGAGGGGGCGG + Intronic
1140046434 16:71442872-71442894 GCCCTGGGCCTGGAAGGGGGAGG - Intergenic
1140441493 16:74991428-74991450 CCCCTTGGCCTGGGGGAGGGTGG + Intronic
1140470193 16:75209433-75209455 GGCCTTGGCCAGAGTGGGAGCGG + Intergenic
1141628802 16:85275801-85275823 GCCCTCGGCCTGGGAAGGGAAGG + Intergenic
1142004695 16:87684144-87684166 GGCCTTTGCCCGAGAGTGGGAGG - Exonic
1142179654 16:88662221-88662243 GGCCTTGGCTAGAGAGAGGGTGG + Intronic
1142247847 16:88977894-88977916 GCCGTTGGGCTGAGAGAGTGAGG + Intergenic
1143118250 17:4592530-4592552 GCCCTTGGCCTGGCATCGGGGGG + Intronic
1143563937 17:7710202-7710224 GCCCATGGCCTGAGCTGGGGTGG - Exonic
1144671244 17:17133820-17133842 GCCTGTGGCCTGAGAGGCGTGGG + Intronic
1144679125 17:17181242-17181264 GCCCTATGCCAGAGAGGAGGTGG + Intronic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1145866529 17:28245555-28245577 CTCCTTGGCCTGAGCAGGGGAGG + Intergenic
1146571128 17:33954234-33954256 GCCCCAGCCCTGAGATGGGGAGG + Intronic
1146595933 17:34168632-34168654 GCCTTTTCCCTGAGATGGGGGGG + Intronic
1147807332 17:43141130-43141152 GCCAGTAGCCTGGGAGGGGGAGG - Intergenic
1147969641 17:44212534-44212556 TCCCATGGCCTGAGGGGGCGGGG - Intronic
1148178592 17:45587134-45587156 GACCCTGGGCTGGGAGGGGGAGG - Intergenic
1148270561 17:46259321-46259343 GACCCTGGGCTGGGAGGGGGAGG + Intergenic
1148388490 17:47253663-47253685 ACCCTGCGCCTGAGAGGGAGCGG - Intergenic
1148495072 17:48048591-48048613 GCCCTGGGCCTGACAGGGAGGGG + Intronic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1148565577 17:48631169-48631191 GCACTTTTCCTGGGAGGGGGTGG + Intronic
1148860319 17:50601183-50601205 GGCCTTGCCCTGAGCGGGGCTGG - Intronic
1149537065 17:57441233-57441255 GCCCTGGGCCTTGGAGGGAGTGG - Intronic
1149638668 17:58189688-58189710 GCCATTGGCCTGAAGGGTGGAGG - Intergenic
1150225471 17:63522641-63522663 GGCCTGGTCCTGAGAGGAGGGGG - Intergenic
1150388819 17:64779628-64779650 GCCCTTGGACTAAGCGGGGCAGG - Intergenic
1151183709 17:72348640-72348662 GCCTTTGGCTTGAAAGAGGGGGG + Intergenic
1151443031 17:74145869-74145891 CCCCTGGGCCTGAAAGGGGTAGG + Intergenic
1151569965 17:74921258-74921280 GGCCTTGGCCTGGGCGGGGAGGG + Intronic
1151728713 17:75898709-75898731 GCCCTGGGCCTGACGGGAGGGGG + Exonic
1152011493 17:77721644-77721666 GAGCTTTGGCTGAGAGGGGGAGG - Intergenic
1152068263 17:78123121-78123143 GCACTTGCCCTGAGAGGGGAAGG - Intronic
1152146938 17:78574059-78574081 GCCCATGGCCTGGGAAGGTGGGG - Intronic
1152335180 17:79696635-79696657 GCCCTAGGCCTGTGGGGGTGGGG - Intergenic
1152354172 17:79798623-79798645 TCCCTTGGCCAGAGATGGGGTGG + Intronic
1152380612 17:79940790-79940812 GCCCTGGGCACGGGAGGGGGTGG - Exonic
1152502772 17:80724265-80724287 GGCCATGTCCTGAGAGGTGGGGG + Intronic
1152622492 17:81372295-81372317 GCACTTAGCCTGAGTGTGGGGGG + Intergenic
1152635696 17:81429749-81429771 GCCCTGGGCTGGGGAGGGGGTGG - Intronic
1153138113 18:1941252-1941274 CCCCTTGGCCTGCGATGGGAAGG - Intergenic
1157545455 18:48543350-48543372 GTCCTTGGCTTGGCAGGGGGAGG + Intronic
1159914265 18:74174456-74174478 GCCCTTGGCCTGAGAGGTGACGG + Intergenic
1159955013 18:74512979-74513001 GTGCTTGGCCTGAGAGCAGGAGG - Intronic
1160615403 18:80123453-80123475 TCGCTTGGCCTGTGAGGCGGAGG - Intronic
1160863500 19:1247644-1247666 GCCCATGGCCAGGGTGGGGGTGG + Intergenic
1160871101 19:1278408-1278430 GACCTTGGCCTGTTGGGGGGTGG + Intronic
1161008465 19:1948173-1948195 ACCCTGGGGATGAGAGGGGGAGG - Intronic
1161248385 19:3267585-3267607 TCCCTTGGCCAGTGAGGGAGGGG + Intronic
1162013007 19:7829590-7829612 GGCCTAGGCCAGAGATGGGGCGG - Intergenic
1162460529 19:10811568-10811590 GCCCTCGTCCTGAGTGGGGTGGG + Intronic
1162534142 19:11253298-11253320 GACTTTCGCCTGAGAGGGGTGGG - Intronic
1162675499 19:12295174-12295196 TCCCTTGGCCTCAGAGCAGGAGG + Intergenic
1163118003 19:15200010-15200032 GCCATTGTCCCGAGCGGGGGAGG + Intronic
1163582175 19:18145484-18145506 GCCCTTGGGCTGGGAGAGGGAGG - Intronic
1165382788 19:35493018-35493040 ACCCATGTCCTGAGAGTGGGGGG + Intronic
1165779915 19:38426233-38426255 CCCCCTGGCCTGAGGGTGGGTGG - Exonic
1165854416 19:38871041-38871063 GCCCTGGGCCTCTGAAGGGGAGG - Intronic
1165895907 19:39140707-39140729 GCCCTTCGCTGGAGAGGGGTAGG - Intronic
1165942222 19:39420669-39420691 GGCCTTGGGCTGGGAGGGTGTGG + Intronic
1166764638 19:45245471-45245493 GCCCCTGGCCCCAGAGAGGGAGG - Intronic
1166977243 19:46611929-46611951 GCACTTGGCCTCAGAGGGCAGGG + Intergenic
1167435949 19:49478842-49478864 GCCTTTGGCCTGCGGAGGGGCGG + Intronic
1167618937 19:50550907-50550929 GCCCTTTGGCTAAGAGGGTGTGG - Exonic
1167709966 19:51104497-51104519 GCGCTTGGCCCGAGAGCGGACGG + Exonic
1167934583 19:52896174-52896196 TCCCTTGGACAGGGAGGGGGAGG - Intronic
1167944667 19:52978541-52978563 GCCATTGGCCTGGCAGGAGGAGG + Intergenic
1168488044 19:56781682-56781704 ACACTAGGCCTGTGAGGGGGAGG - Intronic
925189110 2:1868697-1868719 GCCCTGGGGCTGAGAGGCAGGGG + Intronic
925638486 2:5965211-5965233 GCCCTTGGCCTGGATGGGAGGGG + Intergenic
926693589 2:15754596-15754618 TCCCATGGCCTGAGAGTGGGTGG + Intergenic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
928319020 2:30268570-30268592 GCCCTGGGCCTGGGAGCAGGGGG + Intronic
928913700 2:36448896-36448918 GCCCTTGGTCAGAGAGAGGCAGG - Intronic
930626019 2:53698232-53698254 GCCCTGGGCCTGTGATGGGAGGG + Intronic
930693881 2:54391448-54391470 GCCCCAGGCCTCAGAGGGGTGGG + Intergenic
932593323 2:73079891-73079913 GCCCAAGGCGGGAGAGGGGGCGG + Intronic
932741012 2:74291154-74291176 GCACTTTGCCTGAGAGGTGGAGG - Intronic
936283200 2:111160446-111160468 CCCCTTACCCTGAGAGGGGCAGG + Intronic
936716368 2:115191627-115191649 GCCCATGACTTGGGAGGGGGCGG + Intronic
937311973 2:120908238-120908260 GGCTTTGGCCTGAGTGGGGCTGG + Intronic
938780888 2:134583784-134583806 GCCATGGGCCTGAGAGCAGGGGG - Intronic
939969785 2:148645499-148645521 GCCCCGCGCCTGAGAGAGGGAGG - Intronic
940800108 2:158123735-158123757 GGCCTTGGCCTGAAAGGGAGGGG - Exonic
944414485 2:199468774-199468796 GAGCTTGGCCTGAGGGGCGGGGG - Intronic
946077895 2:217090857-217090879 TGACTTGGCCTGAGAGAGGGTGG - Intergenic
946339575 2:219059042-219059064 GCTCTGGACCCGAGAGGGGGCGG - Intronic
947102585 2:226637305-226637327 GCCCTGGGCCAGTGAGGGGTCGG + Intergenic
947746270 2:232508811-232508833 GTCCTTGGCCTTAGTGTGGGCGG + Intergenic
947978390 2:234387098-234387120 GCCCTTGGCCTGGGCAGGAGTGG + Intergenic
948378014 2:237534848-237534870 GCTCTGGGCATGAGAGGTGGTGG - Intronic
948440370 2:237983338-237983360 GTCCTGGCCCTGAGAGGGAGTGG + Intronic
948593189 2:239064080-239064102 GCCCTTGCCATTAGAGGGAGAGG - Intronic
948816271 2:240511872-240511894 GCACATGGCCTGCGAGCGGGAGG - Exonic
949033163 2:241805967-241805989 TCCCTTGGGCTGAGGGGGGAGGG - Intergenic
1168858662 20:1029065-1029087 GCCATTTCTCTGAGAGGGGGAGG + Intergenic
1169402881 20:5298092-5298114 GCTCTTGGCCTGCCAGAGGGAGG + Intergenic
1171901400 20:30861705-30861727 GCTCTTGGGCTGAGATGAGGGGG + Intergenic
1172123516 20:32612104-32612126 CCCATTGGCCTGAAAGGGGCAGG + Intergenic
1173138978 20:40465446-40465468 GTCATTGGCCTGGGATGGGGAGG - Intergenic
1173475111 20:43353367-43353389 CTCCTTGGCCTTAGAGGGAGAGG - Intergenic
1174113726 20:48213289-48213311 CCACTTGGACTGAGAGTGGGAGG + Intergenic
1174458950 20:50669437-50669459 GCCTCAGGCCTGAGAGGGGAAGG - Intronic
1174899173 20:54480457-54480479 ACCCTTGGTCTGAAAAGGGGAGG + Intronic
1175424739 20:58856053-58856075 GCCCTTGGCCTGGGGGAGCGGGG + Intronic
1175866163 20:62178228-62178250 TCACTGGGCCTGAGAGGTGGAGG - Intronic
1176254888 20:64146701-64146723 GCCCTGGGACTGGGAGGGTGGGG + Intergenic
1178610221 21:34073449-34073471 GCCCGCGGGCGGAGAGGGGGCGG + Intronic
1180139042 21:45880270-45880292 GCCCTGGGCCTCGGAGGGGAGGG + Intronic
1181029040 22:20141203-20141225 GCCCTTGGACTGGGAGGGAGCGG - Exonic
1181514214 22:23402147-23402169 GCCCTTGGACTGGGAGGGGGCGG + Intergenic
1182441735 22:30368629-30368651 CACCTTGGCCAGAGAGGGGCGGG + Intronic
1182612613 22:31561481-31561503 GCTCAGGGCCTGAGAGGGGGTGG + Intronic
1182691150 22:32164321-32164343 GCCCTTACCGTGAGAGGGGGCGG + Intergenic
1183271007 22:36862593-36862615 GCCTTAGCCCTCAGAGGGGGAGG + Intronic
1183698322 22:39435795-39435817 GTCCTTGGCTTGATAGGAGGTGG + Intronic
1183705085 22:39471079-39471101 GCCTTTGGTCTGAGTGGGGGTGG - Intronic
1183725464 22:39586808-39586830 GCCATTGAACTGAGAGGGTGAGG - Intronic
1184497141 22:44848589-44848611 GCCCTGGGCCTGAGACAGGCAGG - Intronic
1184518336 22:44977034-44977056 GACCTGGGCCCGAGAGGGTGAGG + Intronic
1184786198 22:46673178-46673200 GCCCTGGGCTTGGGAGGGGCTGG - Intronic
1184892753 22:47389718-47389740 GGCCTTGTCCTGGGTGGGGGAGG - Intergenic
1203285728 22_KI270734v1_random:153536-153558 GCCCTGGGCCTGATGAGGGGTGG - Intergenic
949924376 3:9029384-9029406 TCCTTTTGCCTGAGAGGAGGAGG + Intronic
949965610 3:9353586-9353608 GCCCTTGGCTTGAAAGGGCACGG + Intronic
950666303 3:14497392-14497414 GCCCTCGTCCTGTGAGGGGTGGG + Intronic
951427474 3:22564313-22564335 GCACTTGGTCTGAAAGGCGGAGG + Intergenic
952392606 3:32893188-32893210 GGCCTTGGGGGGAGAGGGGGCGG - Exonic
954302428 3:49706981-49707003 GCCAGAGGCCTGAGAGGGTGGGG - Intronic
956869146 3:73399377-73399399 GTACTTGGCCAGAGAGGTGGGGG + Intronic
961458715 3:127036957-127036979 CCCCTTGGCCTGAGGGGCTGGGG + Exonic
961472063 3:127121576-127121598 GGCCCTGGCCTCAGAGGGGATGG + Intergenic
962254413 3:133860631-133860653 CCCCTTGGCCTGGGAGGGCAAGG + Intronic
962419288 3:135214201-135214223 GCAAATGGCCTGAGAGGAGGGGG - Intronic
962848183 3:139288890-139288912 GCCCCTGGAGGGAGAGGGGGAGG + Intronic
964491606 3:157242020-157242042 GCCCTAGGGCTCAGAGAGGGGGG + Intergenic
965991103 3:174819139-174819161 GCCCTGAGCCTGGGAGGTGGAGG - Intronic
966499877 3:180627032-180627054 GCCCATGGCCAGAGAGGTTGTGG + Intronic
967840758 3:194003142-194003164 GCCCTTCCCCTGGGAGCGGGAGG - Intergenic
968762384 4:2449426-2449448 GAGCTTGGCCTGGGATGGGGTGG - Intronic
968905135 4:3447405-3447427 TCCGTGGGCCTGACAGGGGGTGG + Intronic
969291488 4:6242885-6242907 GCCCCTGGCATGAGAGGGGTGGG + Intergenic
969719470 4:8885340-8885362 GCCCCAGGCCTGAGAAGGAGTGG + Intergenic
972577352 4:40364212-40364234 ACTCTAGGCCTGAGAGGAGGTGG + Intergenic
972779794 4:42277055-42277077 GGCATGGGCCTGAGAGGGAGGGG + Intergenic
974410747 4:61538830-61538852 GCCCCTGCCCTGACTGGGGGTGG + Intronic
980852624 4:138401553-138401575 GGTCTTGGCCTGAGTGGGGAGGG + Intergenic
982357996 4:154490578-154490600 GCGCTTGGACCGAGAGGAGGCGG - Intronic
982823373 4:159972528-159972550 GCCTTTGGCCTGTGATGGGAGGG + Intergenic
985574100 5:665694-665716 GGAGTTGGCCTGGGAGGGGGTGG - Intronic
985638933 5:1054155-1054177 GCCCTTGGCCAGACAGGGGCAGG - Intronic
985810022 5:2075866-2075888 GACCCTGGCCTGGGAGGAGGTGG + Intergenic
986271277 5:6233028-6233050 GCCCTGGGGCTGAGAAGAGGAGG + Intergenic
986751886 5:10794824-10794846 GCCCTTGGCATCAGAGTGAGAGG - Intergenic
986801848 5:11268509-11268531 GAACTTGACCTGAGAGGTGGAGG + Intronic
987965277 5:24864652-24864674 GCCCTTGGCCTGGGGGCCGGGGG + Intergenic
990825365 5:59893128-59893150 ACCCTTTGCCTGAATGGGGGAGG + Intronic
992261314 5:74973356-74973378 GCCATTGCCCAGAGTGGGGGTGG - Intergenic
993775276 5:91986905-91986927 TCCCTTGGCCTGAAAGGGCAGGG - Intergenic
997283553 5:132663119-132663141 GCCCTGGGCTGGAGAGGGCGTGG + Intergenic
998136413 5:139676588-139676610 GCCCAAGGCCTGAGAAGAGGAGG - Intronic
998203798 5:140145439-140145461 GCCCTTGGCCTTATGGGAGGTGG - Intergenic
998926695 5:147134584-147134606 GCCATTGATCTGAGAGGAGGTGG + Intergenic
999515932 5:152301402-152301424 GACCATGGCCTGAGAGGGTGTGG + Intergenic
1000121606 5:158203282-158203304 GCCATTGGCCTGGGAGGGGCTGG + Intergenic
1001137659 5:169115873-169115895 GCCCTTGTCCAAAGTGGGGGTGG - Intronic
1001415559 5:171542844-171542866 GCCCCTGGCCTGGGAAGGGCTGG + Intergenic
1002213480 5:177611838-177611860 GCGCTTGGCCAGTGAGGCGGTGG + Intergenic
1002271661 5:178076342-178076364 GCCTTGGGGCTGAGAGGCGGGGG + Intergenic
1002796324 6:473917-473939 GCCCTAGGCCTGGGAGGCTGTGG - Intergenic
1006460773 6:34156532-34156554 CCACTTTGCCTGAGAGGGTGGGG - Intergenic
1006778445 6:36615057-36615079 GCACTTGGGCTGAGAGGCAGAGG + Intergenic
1007665419 6:43510399-43510421 GGCCTTGGCCGGGCAGGGGGCGG - Exonic
1014262690 6:119237559-119237581 GACCTTAGCCAGAGAGGGAGAGG - Intronic
1015094485 6:129398557-129398579 TCACTTGACCTGAGAGGTGGAGG - Intronic
1015306783 6:131717410-131717432 GCCCTTGGGGTGAGAGGTGAGGG + Intronic
1015750097 6:136550470-136550492 GCCGCTGGCCTGGGAGGCGGGGG - Intronic
1016708884 6:147146056-147146078 GCACTAGGCCTGAGAGGAAGAGG - Intergenic
1018008412 6:159645566-159645588 TCGCTTGACCTGGGAGGGGGAGG - Intergenic
1018043403 6:159945076-159945098 GCCCTAGGCCTGTGATGGGAGGG - Intergenic
1018792117 6:167156919-167156941 GCCCTTTGCCTCGGAGGGTGTGG + Exonic
1018904752 6:168069198-168069220 GTCCTTGGCCTGTTATGGGGTGG - Intronic
1019305670 7:333180-333202 GCCCTTGCCCAGGGAGGGGCCGG + Intergenic
1019365402 7:630174-630196 GCCCTGGTCCTGGAAGGGGGAGG - Intronic
1019389310 7:776778-776800 GCCCATGGCCTGGGTGGCGGGGG - Intronic
1019410407 7:904264-904286 CTCCTTGGCCTGAGAAGGGGTGG + Exonic
1020007519 7:4790389-4790411 GCCCTTGGCCTGGATGGGGATGG + Intronic
1022048601 7:26643629-26643651 GCCCTTGGTCTCAGTGGCGGCGG + Intronic
1022286668 7:28960294-28960316 GCACCTGGCCTGAGAGTGTGAGG + Intergenic
1022539184 7:31120820-31120842 GCCCCAGGCTTGAGAGGGGAAGG + Intergenic
1023011007 7:35924892-35924914 GCGCCTGGCCAGAGAAGGGGAGG - Intergenic
1023294822 7:38703488-38703510 TCCCTGAGCCTGGGAGGGGGAGG + Intergenic
1023986501 7:45100208-45100230 GACCTTGGCCAGAGTGGGGAGGG - Exonic
1024080120 7:45848951-45848973 GCGCCTGGCCAGAGAAGGGGAGG + Intergenic
1024364069 7:48501106-48501128 ACCCTTGGCCTGACAGGGGCAGG + Intronic
1028193293 7:87876431-87876453 GCGCGTGGCGTGAGACGGGGCGG + Exonic
1028382066 7:90211365-90211387 GCCCTTGGCGAGAGTTGGGGTGG + Intronic
1029123025 7:98281288-98281310 GGGCGGGGCCTGAGAGGGGGCGG - Intronic
1029299330 7:99567001-99567023 GGCTTGGGCCTGAGAGGCGGAGG - Intronic
1030544188 7:110872017-110872039 GCCTTTGCCATGAGAGAGGGAGG - Intronic
1031734051 7:125334028-125334050 GCCCTGGGCCTGTCAGGTGGGGG + Intergenic
1033230790 7:139595897-139595919 GCGCTGGGCCTGGGAGGGGCAGG + Intronic
1034578867 7:152025705-152025727 GCCCTGGGCCTGAGGAGGCGCGG + Intronic
1039890746 8:41683781-41683803 CCCGCTGGCCAGAGAGGGGGCGG + Intronic
1043538579 8:81233317-81233339 GCCCCTGGCCTGAGATGTGTGGG + Intergenic
1045480347 8:102586559-102586581 GCCGTTTCCCTGAAAGGGGGTGG - Intergenic
1048116665 8:131531698-131531720 GCCCTAGGCCTGTGATGGGAGGG - Intergenic
1048256211 8:132906932-132906954 GCCCTAGCCCTGAGAGGGAGCGG - Intronic
1048329782 8:133463767-133463789 GCTCTGGCCCTGAGAGGTGGAGG - Intronic
1049212162 8:141391879-141391901 GCCCCTGGGCTGGGAGGAGGCGG - Intergenic
1049334569 8:142076346-142076368 ACCATTGGCCTGAGAGAGGGCGG - Intergenic
1049510804 8:143025794-143025816 GGCCCTGGCCTGGGATGGGGCGG + Intergenic
1049661029 8:143819837-143819859 GCTCTTGGCCTGCCTGGGGGTGG - Intronic
1055789820 9:79911856-79911878 GCCTTTAGCCTGATAGGGAGTGG + Intergenic
1056694366 9:88833645-88833667 GCCCTCAGCCTGAAAGGAGGAGG - Intergenic
1056949890 9:91033593-91033615 ACCCTTGGCCTGAGTGTGTGTGG + Intergenic
1056972333 9:91216754-91216776 GCCCCAGGCCTGGGAGGAGGGGG - Intronic
1057195080 9:93112167-93112189 CCCCTGGGCCTCAGAGGGGTGGG - Intronic
1059345416 9:113624948-113624970 GCCTGTGGCCCCAGAGGGGGTGG - Intergenic
1059885864 9:118743930-118743952 GTCCTTGGCCTGAGCGTTGGAGG + Intergenic
1060599516 9:124868893-124868915 GCCCCTGGCCTCAGCGGGGCCGG - Exonic
1060666702 9:125436076-125436098 GGCCTGGGCCTCAGAGGTGGGGG + Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1060883489 9:127134906-127134928 TCACTGGGCCGGAGAGGGGGTGG - Intronic
1060995569 9:127873483-127873505 GCCCAGGGCCTGAGAGGGGAAGG - Intronic
1061034558 9:128106421-128106443 GATCCTGGCCAGAGAGGGGGTGG + Exonic
1061038910 9:128128447-128128469 GCCCGGCGCCCGAGAGGGGGCGG + Exonic
1061194841 9:129102144-129102166 GGCCTTGGCCTTGGAGGGGATGG + Intronic
1061225719 9:129279767-129279789 GCCCATGGCCTGGGAGGGGGTGG + Intergenic
1061250418 9:129423095-129423117 GCCCTTTGCCGAGGAGGGGGTGG + Intergenic
1062321261 9:135991459-135991481 GCCCTTGGGCTGTGATGGGCAGG + Intergenic
1062347209 9:136120472-136120494 GCCCGTGGCCAGATAGAGGGTGG + Intergenic
1062535609 9:137019937-137019959 GACATTGGCCTGGGAGGGGAGGG - Intronic
1062576211 9:137209588-137209610 GCCCATGGCCTCAGAGGCAGGGG + Intronic
1185706234 X:2268167-2268189 GGGCTTGGCCTGACAGGGGTGGG - Intronic
1189226255 X:39415663-39415685 GCCCTGAGCCTGGGAGGTGGAGG + Intergenic
1198778624 X:140208858-140208880 GCAATTGGCCTGGGAGGTGGGGG + Intergenic
1200014227 X:153146897-153146919 GACCCTGCCCTGAGAGGTGGAGG - Intergenic
1200025373 X:153253055-153253077 GACCCTGCCCTGAGAGGTGGAGG + Intergenic
1200753834 Y:6971553-6971575 GCCATTAGTATGAGAGGGGGAGG + Intronic