ID: 1096910569

View in Genome Browser
Species Human (GRCh38)
Location 12:54979813-54979835
Sequence CTCTGTTTTCCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096910565_1096910569 29 Left 1096910565 12:54979761-54979783 CCTGTAGAGGTATGTCATAATTA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 37
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096910569 Original CRISPR CTCTGTTTTCCCAGGGAAGC AGG Intronic
901502317 1:9660610-9660632 CTCTGTTTTCCCGGTGGATCTGG - Intronic
902661614 1:17908108-17908130 CTCTGCTTTCCCTGGGTAGATGG - Intergenic
903434669 1:23338062-23338084 CTGTGTTTTCCCAGGGTAGAAGG - Intronic
903731304 1:25497679-25497701 CTCTGTTTTGTCAGAGAACCTGG + Intronic
904128497 1:28259404-28259426 GTCTGTTTCCCCGGGGAGGCGGG - Intergenic
904175828 1:28628085-28628107 CAGTGTTTTTCCTGGGAAGCTGG - Intronic
904966565 1:34378848-34378870 CTCAGTTTTCCCAAGGATGTAGG + Intergenic
905787755 1:40771456-40771478 CTCTTTTCTCCCAGGGACCCAGG + Intronic
906836301 1:49086360-49086382 TCCTCTTTTCCCAGGAAAGCAGG + Intronic
906953706 1:50355042-50355064 TTCTGTTCTCCCTGGTAAGCTGG + Intergenic
907234424 1:53032302-53032324 CTCTGTGTTCCCTGAGAGGCAGG - Intronic
908727369 1:67191265-67191287 TTCTGTTTTCTCAGGAAAGTAGG - Intronic
909117458 1:71556192-71556214 CTCTGTTTTGCAAGGAAATCTGG + Intronic
910837750 1:91532756-91532778 CTCTGCTTTCCCAGAGAGGATGG - Intergenic
911171591 1:94776138-94776160 CTCTCTTACCTCAGGGAAGCGGG - Intergenic
911177096 1:94827723-94827745 CTCTGCTTTCTCTGGAAAGCTGG + Intronic
911247282 1:95532579-95532601 CCCAGTCTTCCCTGGGAAGCTGG - Intergenic
912006736 1:104912240-104912262 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
912425932 1:109590131-109590153 CTCTGTTTTATCAAGGAAGTTGG + Intronic
912432074 1:109633256-109633278 CTTTGTTTTAACAAGGAAGCAGG + Intergenic
912510714 1:110188491-110188513 TTCTGTTTTCCCTGTAAAGCAGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913038336 1:114997212-114997234 TTCAGTTTTCTCAGTGAAGCTGG + Intergenic
913120762 1:115738381-115738403 CTCTGTTTCCCCAGTGAAGAAGG - Intronic
915009565 1:152672882-152672904 TTCTGGTTTCCCAGGGGATCGGG + Intergenic
915148823 1:153812489-153812511 CTCTCTTTCTCCAGGAAAGCTGG + Intronic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915781191 1:158552466-158552488 TTCTGATTTCCCAGGGAGGGTGG + Intergenic
916162196 1:161928796-161928818 ATGTGTTTTCCCAGGAAAACTGG + Intronic
916173324 1:162018333-162018355 CTCTGTTTCCCCAAGATAGCTGG + Intronic
916285695 1:163102505-163102527 CTTTGGTTTCCCAGGCTAGCAGG - Intergenic
918698957 1:187582720-187582742 TTCTGTTTTCCCAGGGCAAAGGG - Intergenic
920196478 1:204230586-204230608 CCCTGTTTTCCCATGGCAGCAGG - Exonic
920695660 1:208179779-208179801 CTCTGGCTTCCCTGGGCAGCAGG - Intronic
921213773 1:212920723-212920745 CTGTGCTCTCCCAGGGAAGAGGG + Intergenic
921665901 1:217870212-217870234 CTCTGTTCTTCCAGAGAAGGTGG + Exonic
922709514 1:227816239-227816261 CACTGCTTTCACAGGTAAGCGGG + Exonic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
922752828 1:228078885-228078907 CCTTGTTTTCCCAGGCAGGCTGG - Intergenic
923448678 1:234096292-234096314 GGCTGCTTTCCCAGGGAGGCTGG - Intronic
923761078 1:236844764-236844786 TTCTGTTTTCTCAGTGAAGTTGG + Intronic
1063023421 10:2153700-2153722 CCCTTTTTTTCCAGGGTAGCAGG + Intergenic
1064185645 10:13159673-13159695 CTCTGTATGCCCAGGGAAAGCGG - Intergenic
1065134127 10:22651447-22651469 CTCTGTTCTCCCAGCGAGCCTGG + Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068289441 10:54983867-54983889 CTCTGTTTTTACAGGGAATGGGG - Intronic
1068749119 10:60571131-60571153 GTCTGATTTCCCAAGGGAGCAGG - Intronic
1069231141 10:66009814-66009836 CTCGGTTTTCCCAGAGAATCTGG + Intronic
1069380360 10:67838030-67838052 CTCTTGTTTCCGAGGGAAGAAGG - Exonic
1069659124 10:70112021-70112043 CTCCTTTTTCCAAGGGAAGAGGG + Exonic
1069885446 10:71620649-71620671 GGCTGTTTTCCCAAGGGAGCTGG + Intronic
1069896871 10:71685503-71685525 CTCTGTGGTCCCAGGGAGGGAGG - Intronic
1070231886 10:74576529-74576551 CTCATTTTTTCCAGGGAAGAAGG - Intronic
1070565781 10:77602966-77602988 CTCTTCCTTCTCAGGGAAGCCGG + Intronic
1071031959 10:81195477-81195499 TTATGTTTTCCCAGGTATGCAGG - Intergenic
1071215902 10:83401062-83401084 CTCAGTGTTCCCAGGGAGACAGG + Intergenic
1072032996 10:91539169-91539191 CCCTGGTTTTCCAGGGAAACAGG - Intergenic
1074544331 10:114390809-114390831 CCCCATTTTCCCAGGGACGCTGG - Intronic
1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG + Intronic
1075486799 10:122829169-122829191 CTCTGCTTTCCCAAGGCAGGGGG - Intergenic
1076184632 10:128436697-128436719 CTCTATTTATCCTGGGAAGCTGG - Intergenic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1078064776 11:8071277-8071299 CACTGCTCTCCCAGGGAAGTGGG + Intronic
1078467589 11:11561708-11561730 GTGTGGTTTCCCAGGGAAACAGG + Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1080296961 11:30741204-30741226 CTCTGTTGGGCCATGGAAGCTGG + Intergenic
1080877824 11:36292618-36292640 CCCAGTTTTCCCAGGGATGAGGG + Intergenic
1083363620 11:62128385-62128407 GTCTGTTTTGCCAGGTAGGCGGG - Intronic
1083827334 11:65211097-65211119 CTCTGGTTTCCCAGGGGTGGAGG + Intronic
1084166934 11:67379476-67379498 CTCTGGCTTCCCCGGGAAGCAGG - Intronic
1084456049 11:69268844-69268866 CTCTGCGGTCTCAGGGAAGCTGG - Intergenic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1084727017 11:70948519-70948541 CTCTGTGTTCCCATAGAAACAGG - Intronic
1084984414 11:72855241-72855263 CTCTTGTTGCCCAGGCAAGCTGG - Intronic
1085049456 11:73372654-73372676 CACTGTTTGCCCTGGGCAGCAGG - Intergenic
1085084092 11:73655417-73655439 CCCTGTGTTCCCAGTAAAGCTGG - Intronic
1087632533 11:100667442-100667464 CTCTATTTTCCCAGGGGTACAGG - Intergenic
1088358828 11:108970252-108970274 GTGTGGTTTCCCAGGAAAGCTGG - Intergenic
1088927380 11:114316027-114316049 GTCTGTTCTCCGACGGAAGCCGG + Intergenic
1089211474 11:116806674-116806696 GTCTGTGTTCCCAGGGACTCAGG - Intergenic
1089844397 11:121447081-121447103 CTCTATATTCCCAGGGAAAGAGG + Intergenic
1089919688 11:122196896-122196918 ATCTGTTTTCCCAATTAAGCTGG + Intergenic
1090737621 11:129624101-129624123 CTCTGTGCATCCAGGGAAGCTGG + Intergenic
1091560126 12:1605826-1605848 TTCTGTTTTCCAAGGGAAGTAGG + Intronic
1092181596 12:6450527-6450549 CTCTGTTTTTCCAGAGATGCTGG + Exonic
1096526173 12:52211680-52211702 CTTTCTGTTCCAAGGGAAGCTGG + Intergenic
1096673281 12:53213038-53213060 CTCTGTCTTCCCAGGGCTGTTGG - Intronic
1096867480 12:54573412-54573434 CTCTGTTTTCCGATTGATGCAGG + Exonic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1097689734 12:62723582-62723604 CTCTGTTTTCACATGGCAGAAGG - Intronic
1099048362 12:77752270-77752292 CTCTGTTTTGACATGGAAGCTGG + Intergenic
1100005051 12:89885117-89885139 CACTGTTTTCCCAGGGACCCTGG + Intergenic
1100006514 12:89901469-89901491 CTCTCCCTTCCCAGGGAGGCAGG + Intergenic
1100183172 12:92107350-92107372 CTCTACTTTCCCAGTGAATCAGG + Intronic
1101434413 12:104652781-104652803 CTCTGTTTGCCTGTGGAAGCTGG + Intronic
1101651020 12:106677202-106677224 CTCTGTTTTCCTAGTGAATTGGG - Intronic
1102080125 12:110091108-110091130 CTCTGGGTTCCCAGGGGATCTGG + Intergenic
1102490530 12:113287496-113287518 CACTGGTTTCCCAGGGACACTGG + Intronic
1102992726 12:117326754-117326776 CTTTGTTTCCCCAAGGAAGAGGG - Intronic
1103526841 12:121574855-121574877 CCCCATTTTTCCAGGGAAGCTGG + Intronic
1103560204 12:121789637-121789659 CTGTGCTTTCCCAGGGAGACAGG + Intronic
1104960279 12:132485302-132485324 CCCTGTTCACCCAGGGGAGCAGG - Intergenic
1105225803 13:18430461-18430483 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1105916680 13:24923157-24923179 CTCCGTGTTCCCAGCAAAGCAGG + Intergenic
1106404695 13:29463499-29463521 TTCAGTTTTCCCAGTGAAGTAGG + Intronic
1107662862 13:42657692-42657714 TTCTGTCTTCCCAGAAAAGCAGG - Intergenic
1108935465 13:55876020-55876042 CTCTCTTTTCCATGGGAAACTGG + Intergenic
1110401829 13:75100974-75100996 CTCTGAGTTCACAGGAAAGCTGG - Intergenic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1111777063 13:92677800-92677822 CACTGTTTGCCCAGGAAATCTGG + Intronic
1113453227 13:110428000-110428022 CCCTGTTTTCCCTGAGAAGGAGG + Intronic
1114010259 14:18358812-18358834 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1114223347 14:20716529-20716551 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
1114713819 14:24804356-24804378 CTCAGTTATCCCAGGGAGACAGG - Intergenic
1116726099 14:48562920-48562942 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1116820019 14:49618988-49619010 CTTTGTATGCCCAGGGAAGGAGG - Exonic
1117779753 14:59220522-59220544 CTTTGTTTTCTCAAGGAAACAGG + Intronic
1119742626 14:77024276-77024298 CTCTATTTTCCCCCGGATGCGGG - Intergenic
1120295308 14:82633014-82633036 CTCGGTGTTCCCAGGGGAGTGGG - Intergenic
1122320332 14:100851599-100851621 CTCAGGTTTCCCTGGGCAGCAGG + Intergenic
1122382984 14:101322987-101323009 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1122613938 14:103004047-103004069 GTCTGTGTTCACTGGGAAGCAGG + Intronic
1123706780 15:22956528-22956550 CTGTGTTCTCCCAGGGATGCTGG - Intronic
1124446537 15:29739411-29739433 ATTTGTTCTCCCAGGGAAGGAGG + Intronic
1124848923 15:33317233-33317255 CTCTGGTTTTACAGGAAAGCAGG - Intronic
1125016570 15:34943174-34943196 CTCTGTATGCCCAGGGAAAGCGG + Intronic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1126556235 15:49990720-49990742 CTATGATTTTCCAGAGAAGCTGG + Intronic
1127847584 15:62884896-62884918 CTCAGAGCTCCCAGGGAAGCAGG + Intergenic
1128693290 15:69741957-69741979 ATCCATTTTCCCAGGGAGGCTGG - Intergenic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1129695568 15:77739026-77739048 GCCTGTTATCCCAGGGAGGCTGG - Intronic
1129801524 15:78418478-78418500 ATCTGCTTTCCAGGGGAAGCAGG - Intergenic
1132154368 15:99485394-99485416 CTCTGAGTCCCCAGGGATGCAGG - Intergenic
1132294842 15:100727405-100727427 CTCTGTTTTCCAAGGGTGTCAGG + Intergenic
1133232496 16:4373174-4373196 CTCTCTTCTCCCAGGGGAGTTGG + Intronic
1134133897 16:11667606-11667628 CTCTGTCTTCCCAGGTAGACAGG + Intergenic
1137019398 16:35408618-35408640 CTGTGTTTTCCCAGGTGTGCTGG + Intergenic
1138513998 16:57525986-57526008 CTGTGTCCTCCCAGGGTAGCCGG + Exonic
1138962668 16:62046011-62046033 TTCTGTTTTTACAGGGAAACAGG + Intergenic
1139340266 16:66263860-66263882 CTCTGGTATGGCAGGGAAGCCGG - Intergenic
1139966403 16:70747890-70747912 CTCTGTTCTGACAGGGAAGTAGG - Intronic
1140855437 16:78973843-78973865 TTCCGTTTTCCAAGGGAAGCAGG - Intronic
1140870170 16:79099123-79099145 CTGTGATTTCCCACGGGAGCTGG - Intronic
1140956981 16:79875049-79875071 CTCTGTTTTCTCAGGGTTGAGGG - Intergenic
1143372276 17:6447745-6447767 CTCTGCTCTCCCAGGCAAGTGGG + Exonic
1144018811 17:11222108-11222130 CTCTGCTTTTCCAGGGAATAGGG - Intergenic
1144453050 17:15397171-15397193 CTTTGACTTACCAGGGAAGCTGG - Intergenic
1146138519 17:30344422-30344444 CTTTGTTTTCCCAGGGCCTCTGG + Intergenic
1146611224 17:34306637-34306659 CTCTGTATCCCCAGGAAAACTGG - Intergenic
1147181883 17:38691578-38691600 CTCTGTTTTTGCTGAGAAGCTGG - Intergenic
1147899704 17:43775994-43776016 CTCTGTAATCCCAGAGTAGCTGG - Intronic
1149567961 17:57652924-57652946 TTCTGCCTTCCCAGGCAAGCAGG + Intronic
1149822850 17:59796605-59796627 CTCTGTTTTCCTAAGGAAATTGG + Intronic
1149964846 17:61151962-61151984 CTCTGTGTGCCCAGGGAAAGTGG + Intronic
1150236011 17:63593191-63593213 ATTGGTTTTCCCAGGGAAGAGGG + Exonic
1151458491 17:74240814-74240836 ATGTGTTTTCCCAGAGGAGCTGG - Intronic
1151634802 17:75338921-75338943 CTCTGTATGCCCAGGGAAAGCGG + Intronic
1152573413 17:81130221-81130243 CTCTGTGTTCCCAGAGGAGCTGG + Intronic
1153228105 18:2912938-2912960 CTCTGTCTTCCCATGGTAGCTGG - Intronic
1153487497 18:5614690-5614712 CTCTGGTTTCTCAGTGAAGCTGG - Intronic
1154150502 18:11902848-11902870 CTCTCTTCATCCAGGGAAGCTGG - Intronic
1154388915 18:13919807-13919829 CTCTGTATGCCCAGGGAAAGTGG - Intergenic
1155252505 18:23965763-23965785 CTCTGTTTTCCTAGTGAATTAGG + Intergenic
1155925524 18:31651556-31651578 GTCTGTTTTCCTAGTAAAGCAGG - Intronic
1157712470 18:49859403-49859425 GTCTGTTTCCCCAGGAAGGCAGG - Intronic
1157860050 18:51133164-51133186 CTCAGTTTCCCCATGGGAGCTGG + Intergenic
1158167287 18:54554803-54554825 CTCTCTATTGCCATGGAAGCAGG + Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1160529404 18:79554837-79554859 CTCTCCTCGCCCAGGGAAGCTGG - Intergenic
1161243549 19:3236219-3236241 CTCGGTTTTCCTAGTGAAGTTGG + Intronic
1161251101 19:3280808-3280830 CACTGTTTTCCTTCGGAAGCTGG + Intronic
1163397042 19:17069822-17069844 TTCTGTCTTCCCAGTGAAGGAGG - Intronic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
1165982181 19:39734234-39734256 CTCTGAGATCCCATGGAAGCCGG + Intronic
1166441098 19:42816046-42816068 TTCTGCTTTCCCTGGAAAGCTGG + Intronic
1168093381 19:54100442-54100464 CCCCCTTTTCCCAGGGAATCAGG + Intronic
925286634 2:2720728-2720750 CTCTGTTTTCCCATGCTTGCAGG - Intergenic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
925529391 2:4842653-4842675 CTCTGTTTTCAGAGGTAACCAGG - Intergenic
926118411 2:10227675-10227697 CTCTGTTCTCACAGGCTAGCAGG - Intergenic
926243534 2:11105488-11105510 CTCTGGATTCCCACGGCAGCCGG - Intergenic
926505851 2:13714590-13714612 CTCTGTTTTCTTAGAGCAGCTGG + Intergenic
927588750 2:24334606-24334628 CTCTGTATGCCCAGGGAAAGTGG + Intronic
928286257 2:29992493-29992515 CTGAGTTTTGCCAGGTAAGCAGG - Intergenic
929071912 2:38039473-38039495 TTGTATTTTCCCAGAGAAGCGGG - Intronic
929116548 2:38449245-38449267 ACCTGTGTTCCCAGGGAAGAGGG - Intergenic
929616815 2:43316497-43316519 CAGTGTTTTCCTAGGAAAGCAGG + Intronic
930654418 2:53993749-53993771 CTCTATTTTCCCGGAGAAGTAGG + Intronic
930656118 2:54008815-54008837 CTCTGTCTTCTCAGTGAAGTAGG + Intronic
930751972 2:54943137-54943159 TTCTGTTTTCTCAGTGAAGGAGG - Intronic
931282696 2:60808047-60808069 CTCTCTTGTCCATGGGAAGCAGG - Intergenic
931941927 2:67261776-67261798 AACTGGTTTGCCAGGGAAGCAGG + Intergenic
932175244 2:69594945-69594967 CTCTGTATGCCCAGGGAAAGTGG - Intronic
933172266 2:79137334-79137356 CTCTCTTTTCCCAGGACAGGAGG - Intergenic
933979156 2:87536564-87536586 CTGTGTTCTCCCAGGGAGGGGGG - Intergenic
934026239 2:88003528-88003550 CTCAGTCTTTCCAAGGAAGCGGG + Intergenic
934660927 2:96143388-96143410 CCCTGTGTTCCTGGGGAAGCTGG - Exonic
934972638 2:98775350-98775372 CACTGTGTTCTCAGGGAGGCAGG + Intergenic
935053394 2:99543839-99543861 CGCTGTTTTCTCATGGAAGATGG + Intergenic
935567082 2:104620509-104620531 TTCAGTTTTCTCAGGGAAGTAGG - Intergenic
935763642 2:106343609-106343631 CTGTGTGCTCCCAGGGAGGCTGG - Intergenic
936314671 2:111414228-111414250 CTGTGTTCTCCCAGGGAGGGGGG + Intergenic
936344489 2:111664991-111665013 CTTTTTTTTCCAAGAGAAGCTGG - Intergenic
936689044 2:114864175-114864197 CTCTTTTTTTCCATGGAAACCGG + Intronic
938526668 2:132140517-132140539 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
939816624 2:146904764-146904786 CCCTGATTTCCCAGTGAATCTGG + Intergenic
941394311 2:164955567-164955589 CCCTGTTCTCTCAGGGAGGCGGG - Intergenic
941918841 2:170829554-170829576 CGCTGTTTTCACAGGAAAGCAGG - Exonic
945483254 2:210366384-210366406 TTCTGTTTTCCCAGGCTATCTGG + Intergenic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
945969422 2:216221412-216221434 CGCTGTCTTCCCAGGGCTGCAGG + Intergenic
947396457 2:229691929-229691951 CTCTGTTTCCCTAGGGTTGCTGG + Intronic
948408852 2:237743445-237743467 CTCTGCTTTCCCAAGGACCCTGG - Intronic
1168822554 20:785308-785330 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
1168902820 20:1379583-1379605 CTCTGTTGTCCCTGGGAAAGGGG + Intronic
1169209251 20:3756478-3756500 CTCTGTGTGCCCATGCAAGCTGG - Intronic
1169275135 20:4228672-4228694 CTCTGCTTTCCCTGTGAAACAGG - Intronic
1169837191 20:9893444-9893466 CTCTGATTTCACAGGAGAGCTGG - Intergenic
1169933229 20:10856302-10856324 CTCAATTTTCCCAAGGAAGTAGG + Intergenic
1171374693 20:24684557-24684579 CCCTGTTTTCTAAGGGAAGCTGG - Intergenic
1172496403 20:35388414-35388436 CTCTGTGTTCCCAGGTACTCAGG - Intronic
1172568712 20:35952677-35952699 CTATCTTTTTCCAGGGAGGCAGG + Intergenic
1172855955 20:38002587-38002609 CTCTGCATTCCCAGAGTAGCAGG - Intronic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1174049691 20:47759030-47759052 CTCCATTTTCCCAGGGCAGCCGG + Intronic
1174105614 20:48160535-48160557 CTCTGTCTTCACAGAGAAGGGGG - Intergenic
1174196224 20:48774686-48774708 AGCTGCTTTGCCAGGGAAGCTGG + Intronic
1174339961 20:49889360-49889382 CACTGTGTCCCCAGAGAAGCAGG - Exonic
1174426687 20:50436615-50436637 CTCCCTTTGCCCAGGCAAGCAGG + Intergenic
1174781208 20:53390540-53390562 CTCTCTTGTGCCAGGGAAGAAGG - Intronic
1174882551 20:54296332-54296354 GTCTTTCTTCACAGGGAAGCAGG + Intergenic
1175300322 20:57938266-57938288 CTCTGTTTTCCCAGTGATATGGG + Intergenic
1175339652 20:58220229-58220251 CTCCCTTTTTCCAAGGAAGCTGG + Intronic
1175677591 20:60960135-60960157 TGTGGTTTTCCCAGGGAAGCTGG - Intergenic
1175677931 20:60962626-60962648 GACTGATTCCCCAGGGAAGCTGG - Intergenic
1175752845 20:61510991-61511013 CTCTGAGTTCACAGGGAATCTGG - Intronic
1175785051 20:61707057-61707079 CTGTTTTATCCCAGGGAAGATGG - Intronic
1175801199 20:61801905-61801927 CTCTCTTTTGCCATGGAAGGTGG + Intronic
1176769858 21:13059484-13059506 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178451314 21:32704034-32704056 CTCTGTTTTCTAAAGGAAGGTGG - Intronic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179089924 21:38255603-38255625 TTCTGTTTTCCCAGTGGAGATGG - Intronic
1179553368 21:42157267-42157289 CCCAGTCTTCCCAGAGAAGCGGG + Intergenic
1180434755 22:15289613-15289635 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1180516960 22:16153427-16153449 TTCTGTTTTCCCAGGCCATCTGG - Intergenic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181648239 22:24245353-24245375 CTCTGCTTTCCCAGAGCTGCCGG - Intergenic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1183374701 22:37456504-37456526 CTCTCCTTTCCCAGGTACGCAGG + Intergenic
1183521401 22:38297972-38297994 CTCTGGGTGCCCAGGGGAGCCGG + Intronic
1183935176 22:41257875-41257897 TGCTGTCTTTCCAGGGAAGCTGG - Intronic
1184148044 22:42622938-42622960 CTCTGCTTTTCAAGAGAAGCTGG - Intronic
1184865104 22:47197911-47197933 CTCTGTGTTCCCAGGGCCCCGGG + Intergenic
1185285678 22:49999051-49999073 CTTGGTTTTCCCAGGTGAGCTGG + Intronic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950740427 3:15046742-15046764 CACTTTTCTCCCAGGGAAGGCGG + Exonic
953145461 3:40270730-40270752 CTTTGTGGTGCCAGGGAAGCAGG - Intergenic
953409358 3:42681231-42681253 GTCTGTGTTCCTGGGGAAGCTGG + Intergenic
953549088 3:43886597-43886619 CTCTGGATTCCCAGGGCAGAGGG - Intergenic
953670985 3:44962013-44962035 AGCTGTTCTGCCAGGGAAGCAGG - Intronic
953809370 3:46098615-46098637 CTCTGTTTTGCAAGAAAAGCAGG - Intergenic
954640927 3:52097280-52097302 CTTTGTTTTTCCAGGGGATCTGG - Intronic
955143481 3:56292720-56292742 CTCTGTTCCCCCAGGTAAGATGG + Intronic
955710003 3:61768775-61768797 GTGTGTTTGCCCAGGGAAGAGGG + Intronic
956390306 3:68764950-68764972 CTCTGCTTTTTCAGGGATGCTGG - Intronic
956434584 3:69221504-69221526 CTTTGTTTTCCAGGAGAAGCTGG - Intronic
961906140 3:130264603-130264625 CTGGCTTTTCCCAGGGATGCTGG - Intergenic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962644320 3:137420714-137420736 CTCTGGCTTCCCAGGGACCCAGG + Intergenic
963765960 3:149336205-149336227 TTCTGTTTTCTCAGGGAAACAGG + Intergenic
964399702 3:156286078-156286100 GCCTGTTTTTCCAGGGAAGTAGG + Intronic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968185055 3:196627240-196627262 CTCTGGTTTCCCTGGGAGCCCGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
968457817 4:707681-707703 CTCTGTTTTCCCCTGGGGGCCGG + Intronic
968457851 4:707789-707811 CTCTGTTTTCCCCTGGGGGCCGG + Intronic
969484062 4:7461946-7461968 CTCTGCTGTCCCACGGCAGCTGG + Intronic
969990754 4:11260080-11260102 TCCTGTTTTCCCAGGGAACCAGG - Intergenic
970042947 4:11817262-11817284 CTCTGTCATCACAGGGAAGCTGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
970901836 4:21168572-21168594 ATCTGTTATCCTAGGGTAGCTGG + Intronic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971774371 4:30942994-30943016 CTATGTTCTCCCAGGGAAAAAGG - Intronic
971944912 4:33261873-33261895 CTCTGGCTTCTCAGAGAAGCAGG - Intergenic
972885786 4:43485327-43485349 CTCCGTCTTCACAGGGCAGCAGG + Intergenic
976128544 4:81858848-81858870 CTCTACTTTGCCAGGGAAACAGG + Intronic
976530950 4:86151241-86151263 ATCTGTTTTCTCAGGGAAGTAGG + Intronic
977055066 4:92181969-92181991 CTCTTTACTACCAGGGAAGCGGG + Intergenic
977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG + Intergenic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
978650638 4:111000080-111000102 CTCTGTTTTTACAAGGTAGCAGG + Intergenic
978744012 4:112171310-112171332 CTCTGTATGCCCAGGGAAAGCGG + Intronic
981811920 4:148785132-148785154 CTCTGTTTTCCTATGTAACCAGG + Intergenic
982536131 4:156608437-156608459 CTGTGTTTTCCTTGGGAAGGTGG - Intergenic
985975379 5:3415983-3416005 CCCCGTTTCCCCAGGGAAGGAGG + Intergenic
986398912 5:7360144-7360166 TTCTGCTTTCCTACGGAAGCAGG + Intergenic
988548358 5:32177847-32177869 ATCTGTGTTCCCTAGGAAGCAGG - Intergenic
990751489 5:59021631-59021653 CTCTGTTTTCCCTGTAAATCAGG - Intronic
991513990 5:67413660-67413682 CCCTGTTTTCTCAGTGGAGCTGG + Intergenic
993383009 5:87229451-87229473 TTCTGTTTTCTCAGTTAAGCAGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
995314242 5:110749685-110749707 CTCTCTTTTCTCTGTGAAGCAGG + Intronic
997361056 5:133295187-133295209 GTCTGTTTTCTCAGTGAATCAGG - Intronic
997668725 5:135653070-135653092 CTATGTCTTCCCATGGAAGGTGG - Intergenic
997990999 5:138544109-138544131 CTCTGTATCCCCAGGAAAACAGG - Intergenic
998401508 5:141851154-141851176 ATCTCTCTTCCCAGGGAAGGGGG - Intergenic
1001350386 5:170957248-170957270 CTCTGTTTTCCAGGGAATGCAGG - Intronic
1001504642 5:172268397-172268419 CTCTGTTTTCCCTGGAAATCAGG - Intronic
1003050085 6:2772381-2772403 CACAGTCTTCCCAGGAAAGCGGG - Intronic
1003454746 6:6271370-6271392 ATGGGTTTTCCCAGGGTAGCTGG - Intronic
1004828038 6:19445499-19445521 CTCTGTTTTCCCTGGAAACATGG + Intergenic
1005147441 6:22707575-22707597 CTCTCTTGCCCCAGGGAAGAGGG + Intergenic
1005814330 6:29538660-29538682 CTCAGTGTTCTCTGGGAAGCTGG - Intergenic
1006936221 6:37720425-37720447 TTCTCTTCTCCCAGGGAAGGAGG - Intergenic
1007225097 6:40308287-40308309 CCCTGTTATCCCCTGGAAGCTGG - Intergenic
1007716066 6:43857020-43857042 GTCTCTTTTTCCTGGGAAGCTGG + Intergenic
1007835164 6:44668363-44668385 GTCTCTTTCCCCAGGGACGCTGG - Intergenic
1008180282 6:48319773-48319795 TTCTATTTTCTCAGGGAAGCAGG + Intergenic
1008367749 6:50702562-50702584 CTGTGTTTTCCCAGAGAACATGG - Intergenic
1009425274 6:63506935-63506957 CCCTGCAATCCCAGGGAAGCAGG + Intergenic
1011067552 6:83344024-83344046 CACTGTTATCCCAGTGAAGCAGG + Intronic
1014197632 6:118577643-118577665 TTCTGTTTTCCCAGGCCATCTGG - Intronic
1015603534 6:134933488-134933510 CTATCTTGGCCCAGGGAAGCAGG + Intronic
1016294678 6:142562278-142562300 CTCTATTCTCACAGGGAAGAGGG + Intergenic
1020109136 7:5438367-5438389 CTCTGGCTTCTCAGGGGAGCAGG - Intronic
1020153095 7:5698719-5698741 GTCTGTTTTCCCAGAGAAGCTGG + Intronic
1020281092 7:6650460-6650482 CTGTTTTTTCACAGTGAAGCCGG + Intronic
1021688567 7:23211048-23211070 TTCTGTTTTCTCTGTGAAGCAGG - Intergenic
1021911530 7:25390079-25390101 CTCTGTCATCCCAGAGATGCTGG + Intergenic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1022829044 7:34046292-34046314 CTCTCTTTTCTTAGGGAGGCAGG + Exonic
1023221631 7:37925002-37925024 CTCTGTTTTCCCTGAGATGATGG + Intronic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG + Intronic
1024579370 7:50789524-50789546 CTCTATTTGACCAGGGCAGCAGG - Intronic
1027386633 7:77665543-77665565 CACTGATTTACAAGGGAAGCTGG + Intergenic
1029549115 7:101227584-101227606 CTCTGTGCTCCCAGGAAAGGGGG - Intergenic
1030982869 7:116207178-116207200 CTCTGAGTTCACAGGGGAGCTGG + Intergenic
1031015559 7:116572525-116572547 CTCTGTTATCTTAGGGGAGCTGG - Intergenic
1032001324 7:128267401-128267423 CTGTGTTTTCCCAGGGGATGGGG + Intergenic
1034391801 7:150793026-150793048 CTCTTTTTTCCCAGGGAGCTGGG - Intronic
1035331228 7:158098579-158098601 CTCTGGTTTCACAGAGCAGCTGG - Intronic
1036170089 8:6475475-6475497 CTGGGTTTTCCCCGGGATGCTGG - Intronic
1036668421 8:10763652-10763674 CTCTGGTTTCACAGGCAAGATGG + Intronic
1036934133 8:12984534-12984556 CTCTTTTCTCCCAGGAAAGAAGG - Intronic
1037026420 8:14043856-14043878 CTCCTTTTTCCCAGGCCAGCAGG + Intergenic
1037878052 8:22558467-22558489 CTCTGATTTCCCTGCCAAGCTGG + Intronic
1038735841 8:30168687-30168709 ATCTGTTTTCCTAGAAAAGCAGG + Intronic
1039254234 8:35701403-35701425 CTCTGTAGTCCCAGGGATGTGGG + Intronic
1039342350 8:36664871-36664893 CACTGCTTCCCCAGGGATGCCGG - Intergenic
1041572734 8:59355837-59355859 CTCTGTTTTCACTGGGTGGCTGG + Intergenic
1041771251 8:61474767-61474789 CTCTATTTTCCCAGTGAAGCAGG + Intronic
1042452523 8:68965319-68965341 TTTTGTTTTCCCAGTGAAGGAGG - Intergenic
1042660376 8:71148505-71148527 CTCAGGTTTCCCAGAGAAGAAGG + Intergenic
1043503532 8:80879618-80879640 TTCTGTATTCCCAACGAAGCAGG - Intergenic
1046699402 8:117383189-117383211 CTCTGTTTTCCTTAGGATGCTGG - Intergenic
1047324735 8:123825383-123825405 CTCTAGTTTCCCAGGGCTGCTGG - Intergenic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049340531 8:142109920-142109942 CTGTGGTTTCCCTGGGAAACCGG + Intergenic
1049469563 8:142769316-142769338 CTTGGTTTTCCCAGGCAAGAGGG + Intronic
1049479682 8:142815931-142815953 CTCTGGGTTCCCAGGCAGGCTGG + Intergenic
1050259552 9:3827259-3827281 TTTGGTTTTCCAAGGGAAGCTGG + Intronic
1052312877 9:27087446-27087468 TTCTGTGTTCCCAGAGAAACTGG + Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1053619394 9:39800208-39800230 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053705373 9:40747875-40747897 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
1053877554 9:42559547-42559569 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053895100 9:42734830-42734852 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054234140 9:62542147-62542169 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054264762 9:62907235-62907257 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054415449 9:64871482-64871504 TTCTGTTTTCCCAGGCCATCTGG + Intergenic
1055271717 9:74567352-74567374 CTCTCTAGTCCCAGGAAAGCTGG + Intronic
1055942650 9:81665021-81665043 GTCTGTTCTCCCAGGGGACCTGG - Intronic
1056488564 9:87083513-87083535 CTCTTTTCTCCCAGGGACCCAGG - Intergenic
1056578075 9:87870867-87870889 CTCTGCTCTCCCTGGGAACCTGG - Intergenic
1057310571 9:93940558-93940580 GGCTGTTCTCCTAGGGAAGCTGG - Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1059162925 9:112052013-112052035 CTATGTTTTCCCAGTGAAATCGG + Intronic
1059434705 9:114269100-114269122 CTCTGTGGTCCCTGGGAAGAAGG + Intronic
1060300043 9:122369784-122369806 CTCTGTCTCCCTAGGGCAGCTGG + Intergenic
1060893479 9:127202872-127202894 CTCTGCTCTCCCAGGGAGGTGGG + Intronic
1061178334 9:129010300-129010322 CTCTGTGTTCCCAGGGGAAAGGG - Intronic
1062004414 9:134232050-134232072 CTCTGCCTTCCCGGGGAAGCCGG - Intergenic
1062254977 9:135616573-135616595 TTCTCTTTTCCCAGGGGAGAAGG + Intergenic
1187974574 X:24692423-24692445 CTCTGTTCTCACATGGAAGAAGG + Intergenic
1189392316 X:40586491-40586513 CTCTGTTTTCTCTGTGAAGCTGG + Intronic
1190388690 X:49910608-49910630 CTCTGTTTTCTCAGTGAAACCGG - Intergenic
1192337160 X:70231637-70231659 CTTTTTTTTCCAAGGGAGGCAGG + Intergenic
1195517602 X:105795186-105795208 CTCTTTGGTCCCAGAGAAGCTGG + Intergenic
1196199306 X:112867463-112867485 CTGTGTGTTCTCAGGGTAGCAGG - Intergenic
1198662971 X:138990896-138990918 CTGTCTTTTCCCAAGGAAGGGGG - Intronic
1200767198 Y:7090202-7090224 CTCTGGTTTACCAGGGAACAGGG + Intronic
1201379730 Y:13361564-13361586 TGCTGTTTTCCCAGTGAACCAGG - Intronic
1201783195 Y:17745209-17745231 CTCTTTGTTCTCAGGGCAGCTGG - Intergenic
1201818358 Y:18160778-18160800 CTCTTTGTTCTCAGGGCAGCTGG + Intergenic