ID: 1096910812

View in Genome Browser
Species Human (GRCh38)
Location 12:54981973-54981995
Sequence CAGTGTGGGAGGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 11, 3: 123, 4: 1018}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096910803_1096910812 23 Left 1096910803 12:54981927-54981949 CCTATGCCCCAAGCAGTGCCTGT 0: 1
1: 0
2: 0
3: 17
4: 259
Right 1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG 0: 1
1: 0
2: 11
3: 123
4: 1018
1096910807_1096910812 5 Left 1096910807 12:54981945-54981967 CCTGTGAGTTGAGACTGAGAGTG 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG 0: 1
1: 0
2: 11
3: 123
4: 1018
1096910806_1096910812 15 Left 1096910806 12:54981935-54981957 CCAAGCAGTGCCTGTGAGTTGAG 0: 1
1: 1
2: 1
3: 11
4: 241
Right 1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG 0: 1
1: 0
2: 11
3: 123
4: 1018
1096910804_1096910812 17 Left 1096910804 12:54981933-54981955 CCCCAAGCAGTGCCTGTGAGTTG 0: 1
1: 0
2: 0
3: 19
4: 212
Right 1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG 0: 1
1: 0
2: 11
3: 123
4: 1018
1096910805_1096910812 16 Left 1096910805 12:54981934-54981956 CCCAAGCAGTGCCTGTGAGTTGA 0: 2
1: 0
2: 4
3: 24
4: 190
Right 1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG 0: 1
1: 0
2: 11
3: 123
4: 1018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096910812 Original CRISPR CAGTGTGGGAGGAGAGAAGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900190223 1:1349969-1349991 CAGGATGGGAGGAGTGAGGAGGG + Intergenic
900503125 1:3016355-3016377 GAGGGAGGGAGGAGAGAGGAAGG + Intergenic
900503132 1:3016386-3016408 GAGAGAGGGAGGAGAGAGGAAGG + Intergenic
900503159 1:3016489-3016511 GAGAGAGGGAGGAGAGAGGAAGG + Intergenic
900544199 1:3219483-3219505 CAGCGTGGGAGGAGAGCGCAGGG + Intronic
901062496 1:6478577-6478599 GAGAGTGGGAGGAGAGAACTAGG - Intronic
901150242 1:7096488-7096510 CAGGGAAGGAGGGGAGAAGATGG - Intronic
901705702 1:11071456-11071478 CAGCGTGGGAGCAGAGGAGGTGG - Intronic
901769042 1:11521318-11521340 CAGGCTGGGAGGAGAAAGGAGGG + Intronic
901769069 1:11521396-11521418 CAGGCTGGGAGGGGAGAGGAGGG + Intronic
901769082 1:11521430-11521452 CAGGCTGGGAGGGGAGAGGAGGG + Intronic
901769144 1:11521624-11521646 CAGGCTGGGAGGGGAGAGGAGGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901846249 1:11984622-11984644 TAGGGTGGAAGGAGAGCAGAAGG - Intronic
902118290 1:14139893-14139915 AAGTGTGGGAGGAGGGAAAGGGG + Intergenic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902798359 1:18814384-18814406 CAGAGTGGGAGGAGAAAAACAGG - Intergenic
902833110 1:19030203-19030225 GAGGGAGGGAGGAGAGAAGGAGG + Intergenic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
903515740 1:23909658-23909680 TGGGGTGGGAGGAGAGAAGCCGG + Intronic
903649071 1:24912079-24912101 CAGTGCCTGAGGAAAGAAGATGG + Intronic
903662860 1:24989332-24989354 AAGGGTGGGAGGAGAGGAGTTGG + Intergenic
903850813 1:26304820-26304842 AAGTGTGGGAGGCGGCAAGATGG - Intronic
904251168 1:29225338-29225360 CAGTGTATGAGGAGAGAAAGTGG - Intronic
904310789 1:29628299-29628321 CAGTGTTGGAGGAGAGCATGGGG + Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904464169 1:30698269-30698291 CACTATGGGAGGATTGAAGAAGG + Intergenic
904490678 1:30857143-30857165 GAGGGTGGGAGGCAAGAAGAGGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905277193 1:36825894-36825916 CATTGCTGGAGGAGAGATGAGGG + Intronic
905428298 1:37901853-37901875 CAGAGTGGGAGTAGGGAAGCAGG - Intronic
906010916 1:42524696-42524718 CAGGGGTGGAGGAGAGGAGATGG + Intronic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906164816 1:43678327-43678349 CAGTGTGGGGTGACAGGAGAGGG + Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
906322815 1:44827383-44827405 CAGGGTGAGAGGCGAGGAGACGG - Exonic
906355610 1:45104744-45104766 GAGTCTGGGAGGGGAGCAGATGG - Intronic
906473469 1:46150678-46150700 CAGAGTGGAAGCAGAGAAAATGG + Intronic
906702351 1:47869036-47869058 GAGGGAGGGAGGAAAGAAGAAGG - Intronic
906980083 1:50620842-50620864 TGGTGTGGGAGGGGAGGAGATGG + Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907486028 1:54778725-54778747 CAGTGTGGGAGCAGAGATGAGGG + Intergenic
907941866 1:59095921-59095943 CAGTGAGGGAGGAAAAAAAAGGG - Intergenic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908717393 1:67084899-67084921 CAAGGTGGGAGGAGCCAAGATGG - Intergenic
908980861 1:69956320-69956342 GAGTGTGGGTGTGGAGAAGAGGG - Intronic
909058122 1:70846337-70846359 CACTGAGGGAGCAGTGAAGAGGG + Intergenic
909381473 1:75003778-75003800 GAGTGAGGGAGGGGAAAAGAGGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909516349 1:76511479-76511501 CACTGTGGGAGGAAAGGGGAGGG - Intronic
909596986 1:77417173-77417195 CAGAGTGGGAGGAGAGTAAGGGG - Intronic
909778893 1:79517264-79517286 AAGAGTGGGAGGAGCCAAGATGG - Intergenic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
910444268 1:87284538-87284560 CATGGTGGGAGCAGAGAAGTGGG + Intergenic
910726378 1:90344237-90344259 AAGTGTTGCAGGAGAGAGGATGG - Intergenic
910940555 1:92528790-92528812 GAGTGTGGGAGGAGTAACGAGGG + Intronic
911099730 1:94085740-94085762 CACTGTGGCAGCAGAGAAGCAGG - Intronic
911133814 1:94418375-94418397 GAGACTGGGAGGAGAGCAGAGGG - Intergenic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
912493574 1:110076730-110076752 CACTGGAGGAAGAGAGAAGAGGG + Intergenic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
912809649 1:112784396-112784418 CAGTGTGGAAGGTCAGAAGATGG - Intergenic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913188366 1:116391135-116391157 CAAAGTGGGAGGGGAGGAGACGG + Intronic
913298164 1:117342511-117342533 CACTGTGGGATGAGAGAAACAGG + Intergenic
913299815 1:117358708-117358730 CAGAGCGGGAGGAGCCAAGATGG - Intergenic
915087333 1:153397563-153397585 CAGAGTGGGAAGAGACAAGGTGG + Intergenic
915103367 1:153516271-153516293 CAGGGTGGGAGGAGGTAGGATGG - Intergenic
915268766 1:154737087-154737109 GACTGTGGGAGTAGAGAGGAGGG + Intronic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915428283 1:155845118-155845140 GAGTGAGGTAGGAGAGAAGCAGG + Intronic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915626242 1:157115647-157115669 CAGTTTGGGAAGGAAGAAGAGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915871538 1:159564975-159564997 CAGTTGGGGAGGACAGAAGAGGG - Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917240503 1:172942998-172943020 CAGTGTTGCAGCAGAGATGATGG + Intergenic
917251184 1:173062698-173062720 CACTGTGGTAGGTGAAAAGAAGG - Intergenic
917483749 1:175435612-175435634 GAGTGTAGGAGGAGAAAAGAAGG + Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917606147 1:176631927-176631949 CACAGGTGGAGGAGAGAAGAGGG + Intronic
918487342 1:185044120-185044142 CAATGTGGGGGGAGAAAAAAAGG - Intergenic
919661844 1:200255154-200255176 CCGTGTGGGTTGAGAGACGAGGG - Intergenic
919664184 1:200276364-200276386 ATGTGTGGGAGGAGAGAGGATGG - Intergenic
920126864 1:203700398-203700420 CAGAGTCAGAGGAGAGAACAGGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920225322 1:204434292-204434314 CAGCATTGGAGGAGAGAAGACGG - Intronic
920302420 1:204997161-204997183 CAATGTGGGAGGAGCTGAGAGGG - Exonic
920371292 1:205481050-205481072 CAGGGTGGGTGGGGAGAAGATGG - Intergenic
920841922 1:209562357-209562379 AAGTTTGGAAGGAGAGAAGGAGG + Intergenic
920976644 1:210792066-210792088 AAGTGGAGGAGGAAAGAAGATGG - Intronic
921010274 1:211134108-211134130 CAGGGAGGGAGGCGCGAAGAGGG - Intronic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922205979 1:223446986-223447008 CATTCTGGGAGGAGCCAAGATGG + Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922336561 1:224623161-224623183 GAGTGCGGGAGTAGAGAACAGGG - Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922425494 1:225488765-225488787 CAGTTTGGGATGATAAAAGATGG - Exonic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
922987615 1:229878140-229878162 GAGGGAGGGAGGAGAGAAGAGGG + Intergenic
923265086 1:232306503-232306525 GAGTGTGGGAAGGGAGAGGAAGG - Intergenic
923276245 1:232399474-232399496 CAGAGTGGGATGAAAGAACAGGG - Intronic
923290243 1:232538338-232538360 CTGTGTTGGAGAAGAGAAGTGGG - Intronic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924040771 1:239981724-239981746 CACCTTGGGAGGAGAGGAGATGG - Intergenic
924382182 1:243475049-243475071 CAGCCTGGGAGGAGAGGAGCTGG + Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063150633 10:3333268-3333290 CAGTATAGGGGAAGAGAAGATGG + Intergenic
1063197211 10:3754725-3754747 CAGTTTGGGGGGTGAGGAGAAGG - Intergenic
1063225768 10:4013453-4013475 GAGGGAGGGAGGAGAGAGGAAGG - Intergenic
1064106885 10:12507897-12507919 AAGAGAGGGATGAGAGAAGAGGG - Intronic
1064177678 10:13089584-13089606 AAGTTGGAGAGGAGAGAAGAGGG - Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064553260 10:16522776-16522798 CATTGAGGGAGGGGAGAAGTAGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1065768078 10:29050629-29050651 AAGTGTGGGAGGATGGGAGAGGG - Intergenic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1066277297 10:33881523-33881545 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1066287187 10:33979773-33979795 GGGTGTGGGGGGAGAGGAGAAGG - Intergenic
1066502251 10:36005648-36005670 AAGGGTGGGAGGAGAGGTGAGGG + Intergenic
1067044934 10:42980226-42980248 CTGTGTGGGAGGGGAGGTGAGGG - Intergenic
1067102172 10:43341653-43341675 TAGGGTGGGAGGAGAGAAAGTGG + Intergenic
1067321296 10:45223589-45223611 CAGGATGTGACGAGAGAAGAAGG - Intergenic
1067703835 10:48592522-48592544 CGGTGAGGGAGGGGAGAAGCGGG - Intronic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1067799772 10:49351023-49351045 CAGTGTGGGAGGAAACAGGGAGG + Intergenic
1069416314 10:68203968-68203990 CAGCGTGGAGGTAGAGAAGAAGG - Intronic
1069632645 10:69906389-69906411 AAGGGTGGGAGGGGACAAGATGG + Intronic
1069919097 10:71805599-71805621 GGGTTGGGGAGGAGAGAAGAGGG + Intronic
1070173443 10:73950354-73950376 CAGTGTGCGGGGAGAGAATCTGG + Intergenic
1070758083 10:79005883-79005905 CAGGGTGGGAGATGAGGAGAGGG - Intergenic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1070842520 10:79497120-79497142 GACGGTGGGAGGAGAGAAGCTGG + Intergenic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1071182619 10:83004561-83004583 CATTGTGGAAGGAGAAAAGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071531407 10:86392491-86392513 CAGGGTGGGAGTAGAGGAGAAGG + Intergenic
1072762423 10:98067773-98067795 CAGTCTGGTGGGAGAGAAAAAGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073011393 10:100362720-100362742 CAGTGTGGCAGGGGAGCACAGGG - Exonic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073307318 10:102513595-102513617 CGGTCTGGGAGCAGAGCAGAGGG + Intronic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074293551 10:112160259-112160281 AAGAGAGGAAGGAGAGAAGAGGG - Intronic
1074386803 10:113023068-113023090 CATTGTGGGGGCCGAGAAGAGGG + Intronic
1074567684 10:114596082-114596104 CTGAATGGGAGGAGTGAAGAGGG - Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075257816 10:120939391-120939413 GAGCCTGGGAGGAGAGCAGAGGG - Intergenic
1075546020 10:123355327-123355349 CACTCAGGGAGAAGAGAAGATGG - Intergenic
1076244035 10:128932384-128932406 CTCCGTGGCAGGAGAGAAGATGG + Intergenic
1076423511 10:130351176-130351198 CAGGGTGGGGGCAGAGATGAGGG + Intergenic
1076703601 10:132288165-132288187 GAGTGAGGGAGGGAAGAAGAGGG + Intronic
1077126764 11:942949-942971 CAGTGAGCGAGGAGAGGAGCTGG + Intronic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077553957 11:3217219-3217241 CAGTGTGGGAGGGGATGGGAGGG + Intergenic
1077602442 11:3582712-3582734 GAGAGCTGGAGGAGAGAAGAAGG - Intergenic
1077654665 11:4007039-4007061 GAGAGTGGGAGCAGAGAAGAGGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077731176 11:4731553-4731575 CAGTGTGGAAGGAGAGGGTAAGG - Intronic
1077746797 11:4915661-4915683 CATTGTGTGAGGAGACAAGGGGG + Exonic
1078040344 11:7855806-7855828 CTGGGTAGGAGGAGAGAAAAGGG + Intergenic
1078182537 11:9024590-9024612 CAGTGAGAGAGGAGACTAGAAGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1078806974 11:14715903-14715925 CATAGTGGGAGGAGCCAAGATGG + Intronic
1079309237 11:19349795-19349817 CAGGGAGGGAGGAGAGAGGAAGG - Intergenic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1080696063 11:34603887-34603909 GAGAGTGGGTGGAGAGATGAAGG + Intergenic
1080894520 11:36438272-36438294 CCCAGTGGGAGGAGAGAAGAGGG - Intronic
1080895360 11:36444735-36444757 GAATGTGGGAAGAGAGAAAAAGG - Intronic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1081865510 11:46357579-46357601 CAGTGCAGGAGGAAAGAACAGGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1081996655 11:47369448-47369470 CACTCTGGGTGGAGAGCAGATGG - Intronic
1082035681 11:47643409-47643431 CAATGTGGGAGAAAATAAGAGGG - Intergenic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082189910 11:49230628-49230650 CACTGTGGGAGGCTAGAGGAAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083045250 11:59728743-59728765 CAGTGTTGGAGGAGAAATGTTGG - Intronic
1083254424 11:61487417-61487439 GCGTGTGGGAGTGGAGAAGAGGG + Intronic
1083549298 11:63574265-63574287 CAATGTGGGAGGAGAGGAGCAGG + Exonic
1083576145 11:63793252-63793274 CAAAGGGGAAGGAGAGAAGAAGG - Intergenic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1083743343 11:64722540-64722562 CTTCGTGGGAGGAGAGGAGAGGG - Intronic
1083855907 11:65393009-65393031 CAGTGAGAGAGGAGATAAGGTGG + Intronic
1084209063 11:67612588-67612610 AAGGGTGGGAGGGGAGAACAGGG + Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084694661 11:70746328-70746350 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084694692 11:70746427-70746449 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084913813 11:72412345-72412367 CAGTGAGGGAGGGGAGAGGCTGG + Intronic
1085023480 11:73223269-73223291 CAGCTTGGGAGGAAAGAAGGTGG - Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085268145 11:75249940-75249962 CAGTGTGGGACCAGAGAGGGGGG - Intergenic
1085541533 11:77274898-77274920 CAGAGTGGGAGAAATGAAGAGGG + Intronic
1085774919 11:79357042-79357064 CAGAGTGAAAGAAGAGAAGAGGG - Intronic
1085794869 11:79529983-79530005 CAGTGTGGTAGCAGTCAAGATGG - Intergenic
1086089584 11:82992250-82992272 TAGTGTGGGGGGTGGGAAGAAGG - Intronic
1086142257 11:83512214-83512236 CAGGATTGGGGGAGAGAAGAGGG - Intronic
1086746358 11:90432418-90432440 GAGGGTGGGAGGAGAGAGAAGGG - Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1087012670 11:93528660-93528682 CAGAGTGGGTGGAGAGGTGAAGG + Intronic
1087938347 11:104062092-104062114 CTGAGTGGGAGGGGAGAAGAAGG + Intronic
1087952497 11:104240206-104240228 CAGAGCCTGAGGAGAGAAGACGG - Intergenic
1088056882 11:105593616-105593638 GAGGTTGGGAGGAGAGAAAAAGG - Intergenic
1088079667 11:105895755-105895777 CTGTGTGGTAGGAAAAAAGATGG - Intronic
1088374903 11:109130237-109130259 CACTTTGGGAACAGAGAAGAGGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088596410 11:111444246-111444268 CAGAGAGAGAGGAGAGGAGAGGG + Intronic
1089167657 11:116489478-116489500 CAGTGTGGTGGCAGAGAACAAGG + Intergenic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089492070 11:118890018-118890040 CAGACAGGGAGGAGAGAAGCAGG - Intronic
1090058940 11:123447139-123447161 CTGGGTGGGAGAGGAGAAGAGGG + Intergenic
1090245389 11:125212622-125212644 CAGAGAGGGAAGAGAGGAGAGGG + Intronic
1090469711 11:126969365-126969387 CAGTGTGGCAGGTGTGAAGGTGG + Intronic
1090497704 11:127230771-127230793 CGGTATGGGGGGAGAGGAGATGG + Intergenic
1090564424 11:127971679-127971701 CAGTGTCGGTGGAGACAACATGG + Intergenic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1090668433 11:128930436-128930458 CAGGGAGGGTGGGGAGAAGAAGG - Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091225134 11:133952403-133952425 CAGAGTGGGAGGGGATATGAAGG + Intronic
1091440267 12:507476-507498 CACTGTGGGAACAGAGAACATGG + Intronic
1091600554 12:1915389-1915411 CAGACTGAGAGGAGAGAAGGAGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1092091186 12:5804933-5804955 GAGAGTGGGAGGACAGAAAATGG + Intronic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092977634 12:13760737-13760759 AAATGTGGAAGGAGTGAAGATGG - Intronic
1093696267 12:22164212-22164234 CAGTGAGGGCGGAGAAAATAAGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1094736473 12:33240430-33240452 CACAGTGGCAGGAGAGAACAAGG - Intergenic
1095125956 12:38477569-38477591 CAGCATGGAAGGAAAGAAGAGGG + Intergenic
1095319081 12:40803802-40803824 CAGGAAGGGAGGAGAGGAGAAGG + Intronic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095536238 12:43251397-43251419 TAGAGTGGAAGGAGAGATGATGG - Intergenic
1095557101 12:43520802-43520824 AAATGTGTGAGCAGAGAAGAAGG - Intronic
1095726634 12:45460951-45460973 TAGTGGGGGATTAGAGAAGAGGG + Intergenic
1095977673 12:47950851-47950873 CATTGCGGAAGGTGAGAAGAAGG + Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096219670 12:49821141-49821163 CAGTCAGGGAGGAGAAAGGAAGG + Intronic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096621677 12:52869366-52869388 CAGAGGGGGAACAGAGAAGAGGG + Intergenic
1096744337 12:53715694-53715716 CCCTCTGGGAGGAGAGAAGAGGG - Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097037141 12:56131412-56131434 AAGTCTGGGAGGACAGAAGAGGG + Intronic
1097177065 12:57149407-57149429 CAGCGGGGGAGGAGAGGACAGGG - Intronic
1097201242 12:57280640-57280662 CAGTGGGGGAGGGGACAAAAGGG - Intronic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1097963537 12:65555724-65555746 TTGTGTGGGAGGAGCCAAGATGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098855896 12:75652964-75652986 GATTGTGGGAGCAGAGAAGTAGG - Intergenic
1099155763 12:79173994-79174016 CAGTCTAGGAGGAGTAAAGAAGG + Intronic
1099232543 12:80043947-80043969 TACTGAGGGAGAAGAGAAGAGGG + Intergenic
1099258261 12:80343207-80343229 GAGTTTGCTAGGAGAGAAGAGGG + Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099393543 12:82110070-82110092 AAGAGAGAGAGGAGAGAAGAAGG + Intergenic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100569866 12:95837440-95837462 CGGAGAGGGAGGAGAGAAGGTGG + Intergenic
1100734265 12:97509622-97509644 CAGTATGAGAGGGGAGGAGAAGG - Intergenic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101337765 12:103811379-103811401 CAGGAGGGGAGGAGAGGAGACGG + Intronic
1101902227 12:108799216-108799238 CAGTTGGGGAGGAGAGATGGGGG + Intronic
1101908121 12:108842966-108842988 CAGGGATGGAGGAGAGAAAAGGG - Intronic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1102341219 12:112123007-112123029 CACAGTGGGAGGAGACAACAAGG - Intergenic
1102488420 12:113273729-113273751 CACTGTGGGAGTGGAGAAGTGGG + Intronic
1102518955 12:113467473-113467495 CAGTCAGGGAAGGGAGAAGAGGG - Intronic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1106063947 13:26325684-26325706 CCGTTTGGGAGGAGTGAAGCAGG + Intronic
1106309793 13:28544144-28544166 CAGTGTGGGAGAGCAGAGGATGG + Intergenic
1106590917 13:31097923-31097945 TAGTGTGGGAGGAGAAATCACGG - Intergenic
1106910335 13:34456390-34456412 CATAGTGGCAGGAGAGAAGGGGG - Intergenic
1107004391 13:35591589-35591611 CAGTGTTGGATGAGAGAAAAGGG - Intronic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107269195 13:38594348-38594370 AAGTGTGGGAGAGGAGAAGATGG - Intergenic
1107284863 13:38779674-38779696 GAGTGTGTGAGGAGAGGAGCAGG - Intronic
1107486089 13:40828814-40828836 GAGGGTGGGAGGAGCCAAGATGG + Intergenic
1107904642 13:45050866-45050888 CAGAGTGGAAGCACAGAAGAAGG - Intergenic
1108322786 13:49303794-49303816 GCGTGTGGGAGGAAGGAAGAGGG - Intergenic
1108574873 13:51782286-51782308 GAGTGTGGGAGGAGAAAGGAGGG + Intronic
1108623049 13:52202784-52202806 CAGGGTGGGAGGAGAGGTAATGG - Intergenic
1108663676 13:52608258-52608280 CAGGGTGGGAGGAGAGGTAATGG + Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1109270685 13:60252033-60252055 GAGTGAGGGAGGAGCCAAGATGG - Intergenic
1109576730 13:64269100-64269122 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110369797 13:74727401-74727423 AAAAGAGGGAGGAGAGAAGAGGG + Intergenic
1111201416 13:84942691-84942713 GAGTGTGGTAGGAAAGAAGTAGG + Intergenic
1111788349 13:92820009-92820031 CAGAGAGGAAGCAGAGAAGAGGG - Intronic
1111975380 13:94961897-94961919 CAGTGTGGGAGGGGACACCAAGG + Intergenic
1112775788 13:102842992-102843014 CAGTCTGGGAGAAGACAAGTTGG - Intronic
1113657186 13:112074123-112074145 GAGTGTGGGTGAAGAGGAGAGGG + Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113906221 13:113820414-113820436 CAGGCTGGGAGCAGAAAAGAGGG + Intergenic
1114002562 14:18274105-18274127 TGGGGTGGGAGGAGAGAGGAGGG + Intergenic
1114547536 14:23513555-23513577 GGGTCTGGGAGGGGAGAAGAGGG + Intergenic
1114916615 14:27275173-27275195 CAGTTTAGGAGGGTAGAAGATGG + Intergenic
1114982875 14:28188437-28188459 CAGGTTGGGAGGAGCCAAGATGG + Intergenic
1115165098 14:30439362-30439384 CACTGGGGGAGAAGAGAGGAGGG - Intergenic
1115352004 14:32405759-32405781 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116028856 14:39546840-39546862 CAGTGTGCAAGAAGATAAGAGGG + Intergenic
1116402160 14:44521243-44521265 CAGTGTGGGAAGAGTGACTAGGG + Intergenic
1116443473 14:44981026-44981048 AAGTGTTGGAGGAGAGGAGAGGG + Intronic
1117057038 14:51922882-51922904 CAGGGTGGGGGCAGAGGAGAAGG + Intronic
1117186648 14:53246750-53246772 CAGTGTGGGAGTCCAGAGGAGGG - Intergenic
1117258046 14:54000314-54000336 GATTGTGTGAGGAGAGGAGATGG + Intergenic
1117568596 14:57022566-57022588 TCCTGTGGCAGGAGAGAAGAAGG - Intergenic
1118171826 14:63395860-63395882 GAGTCGGGGAGGAGAGGAGAAGG + Intronic
1118338642 14:64877067-64877089 CAGTGTGATAGGACAGAGGATGG - Intronic
1118478554 14:66141517-66141539 CAGTGTGGGAAGGGAGCAGGTGG - Intergenic
1118697026 14:68395178-68395200 AAGGGTGGGAGCACAGAAGAAGG - Intronic
1118771438 14:68945286-68945308 CAGTGCAGGAGGGAAGAAGAGGG + Intronic
1118812402 14:69284896-69284918 CAGGGTGGCAGGAGAGAGAAGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119201609 14:72756997-72757019 GAGGGAGAGAGGAGAGAAGAGGG + Intronic
1119283191 14:73428464-73428486 GACTTTGGGAGGAGAGAAGGTGG - Intronic
1119401846 14:74368054-74368076 CAGTGAATGAGCAGAGAAGATGG + Intergenic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1119903620 14:78282362-78282384 CACTGGGGGAGGGGAGAAGAAGG - Intronic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1120929858 14:89837327-89837349 GAGTGTGGGAGAAGAGAGGATGG + Intronic
1121066207 14:90968284-90968306 GAGGGAGGGAGGAGAGAGGAGGG - Intronic
1121358450 14:93233853-93233875 CTGAGTGGGAGGTGAGAAGGTGG - Intergenic
1121398285 14:93647616-93647638 AAGAGTGGGAGGAGATGAGAGGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1122018456 14:98817079-98817101 CACTGTGGGAGGACAGAAAAGGG - Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122275388 14:100588167-100588189 CGCTCTGGGAGGAGAGAGGAGGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1124490792 15:30153871-30153893 CAGTCTGGGAGAGGTGAAGAAGG - Intergenic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1124752740 15:32384458-32384480 CAGTCTGGGAGAGGTGAAGAAGG + Intergenic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125608951 15:40958097-40958119 CAGCGTGGAATGGGAGAAGAGGG + Intergenic
1125660752 15:41392958-41392980 CAGGGTGGGAGTAGAAGAGATGG + Intronic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1126572232 15:50164520-50164542 GATTGTTTGAGGAGAGAAGAGGG - Intronic
1126667188 15:51086210-51086232 TGGTGAGAGAGGAGAGAAGAAGG - Intronic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1127401138 15:58587011-58587033 AAGGGTGGGAGGACAGAAGAAGG - Intergenic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127922286 15:63503588-63503610 TAGTGAGGGATTAGAGAAGAGGG - Intergenic
1128095332 15:64949811-64949833 CAGTGAGGGAGGAGAGAGAGAGG - Intronic
1128258407 15:66214858-66214880 GAGTGTGTGTGGAAAGAAGATGG + Intronic
1128997443 15:72307233-72307255 GTGGGTGGGAGGAGAGAAGGTGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129326916 15:74805043-74805065 CAGTGTGAGAGTGGAGGAGAGGG + Intergenic
1129501005 15:76037842-76037864 CCGCTTGAGAGGAGAGAAGAGGG + Intronic
1129515786 15:76156549-76156571 CAGAGTGGGAGGGGACAAGAGGG - Intronic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129682179 15:77664103-77664125 CTGTGTGGCAGAAGAGAGGAAGG - Intronic
1129784449 15:78299728-78299750 GAGGGTGGGCGGAGAGAGGAGGG + Exonic
1129955919 15:79636782-79636804 GATTGTGGGAGGAAGGAAGAAGG - Intergenic
1130029360 15:80297736-80297758 CAGTGGAGGATGAGAAAAGAGGG + Intergenic
1130165349 15:81451247-81451269 CTCTGTGGAAGGAGAGAAGCAGG + Intergenic
1130421777 15:83755415-83755437 GACTGGGGGAGGAGAGAATAGGG - Intronic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130614769 15:85394615-85394637 GGGGGTGGGAGGAGAGGAGATGG - Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131318705 15:91366055-91366077 CACAGTGGGAGGGGAGAGGAGGG + Intergenic
1131366917 15:91849483-91849505 CATTTTGGTAGGAGAGAAGTGGG - Intergenic
1131656082 15:94460641-94460663 ATGTGTCTGAGGAGAGAAGAGGG + Intronic
1131875572 15:96802570-96802592 AAGAGTGGAAGGAGAGAAAAAGG + Intergenic
1131939058 15:97540717-97540739 CAGTGTGGGAGTATAAAAGCTGG - Intergenic
1132664613 16:1075915-1075937 CAGGGTGGGGGGAGAGAGGGAGG - Intergenic
1133444789 16:5850864-5850886 CAGCGTGGGAGAAGTGATGAAGG + Intergenic
1133797526 16:9058240-9058262 AAGTGAAGGAGGAGAGAAGATGG + Intergenic
1133840592 16:9404884-9404906 AAGTGGAGGAGAAGAGAAGATGG + Intergenic
1134079660 16:11316079-11316101 CAGTAGGGGAGGGGAAAAGAAGG - Intronic
1134187921 16:12098955-12098977 CATTGTGGGAGCAGAGAGTACGG + Intronic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1135475059 16:22766702-22766724 TGGTGGGGGAGGAGAGAATACGG + Intergenic
1135801970 16:25505926-25505948 CAGGCTGGGAGGAGAAAAGATGG - Intergenic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1137081868 16:36071919-36071941 CAGAGAGGGAGGAGTCAAGATGG + Intergenic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137560412 16:49498673-49498695 AAGTGTGGGAGGAAAGGGGAAGG - Intronic
1137694239 16:50450535-50450557 CAGTCATGGAGGAGAGATGATGG - Intergenic
1138207225 16:55133884-55133906 CAGTGTGGGAGGGAAGAGGTGGG - Intergenic
1138238743 16:55408923-55408945 CAGTGAGGGAGGAGGAAAGCAGG - Intronic
1138316266 16:56072923-56072945 CAGTCTGGAATCAGAGAAGAAGG + Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138490244 16:57372398-57372420 GAGGGTGGGAGGGGAGAGGAAGG - Intergenic
1139247795 16:65463432-65463454 CAGGGAGGGAGGAGAGTAGCAGG - Intergenic
1139326552 16:66156828-66156850 CACTGTGGCAGGAGAAAGGAAGG + Intergenic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1141083684 16:81076600-81076622 CTGTGTGAGAGTAGAGAAGACGG - Intronic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141542023 16:84731887-84731909 CAGTGTTGGTGATGAGAAGAAGG + Intronic
1141592673 16:85078904-85078926 CACTGTGGGAGGAGAGAGAATGG - Exonic
1141603111 16:85138005-85138027 GAGGGAGGAAGGAGAGAAGAGGG - Intergenic
1142034667 16:87855710-87855732 CAGTGTTGGAGGAGAGGGGTGGG + Intronic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142225331 16:88874326-88874348 GAGTGTGGGTGGGGACAAGATGG + Intergenic
1142425959 16:90002411-90002433 CCGTCTGGGAGGTGACAAGAGGG - Intergenic
1203143560 16_KI270728v1_random:1784545-1784567 AAGAGTGGGGGGAGAGGAGAGGG + Intergenic
1142669737 17:1482670-1482692 CAGTGCGGGAGGGGAGGGGAGGG - Intronic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1142669776 17:1482777-1482799 CAGTGTGGGAGGGGAGGGCAGGG - Intronic
1142938272 17:3357546-3357568 GAGGCTGGGAGGAGAGGAGAAGG + Intergenic
1142958270 17:3535525-3535547 GAGTCTGGGAGGAGGGAGGAGGG - Intronic
1143504156 17:7354787-7354809 CAGTGGGGGAGGAGATGGGAAGG + Exonic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144590659 17:16520989-16521011 CAGAGTTGGAGCAGAGAGGATGG + Intergenic
1144877633 17:18410791-18410813 CAGTGTGGGAGAAGAGTTGAGGG - Intergenic
1145043907 17:19597120-19597142 TGGTGGGGGAGGAGAGAAGGGGG + Intergenic
1145154597 17:20533612-20533634 CAGTGTGGGAGAAGAGTTGAGGG + Intergenic
1145270101 17:21400292-21400314 CAGGGTGTGAGGAGACAGGAGGG - Intronic
1145308323 17:21687743-21687765 CAGGGTGTGAGGAGACAGGAGGG - Intergenic
1145969576 17:28949298-28949320 CCGGGAGGGAGGAGGGAAGAGGG + Intronic
1146477119 17:33171949-33171971 AAGTGTGTGAGGAGAGAAATTGG - Intronic
1146574620 17:33980289-33980311 GAGTGAGGGAGGTGAGAAGCCGG + Intronic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1146943873 17:36861319-36861341 GAGTGAGAGAGGAGAGGAGAAGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147617279 17:41836852-41836874 CTGGATGGGAGGAGAGATGAAGG + Intronic
1147855400 17:43475906-43475928 CAGTGTGGGAGGGGAGAAACAGG + Intergenic
1148456739 17:47815194-47815216 AGGTGAGGGAGGAGAGAAGCTGG - Exonic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148910089 17:50937648-50937670 CAGTGTGGAACGGGAGAAGGGGG - Intergenic
1148999456 17:51742123-51742145 CTGTCTGGGAGGAGAGAAAGGGG + Intronic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149645710 17:58240082-58240104 TACTGTGGGAGGACAGAAAAAGG + Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1151050972 17:70978465-70978487 GAGGGTGGAAGGAGGGAAGAAGG + Intergenic
1151063931 17:71129313-71129335 AAGTGTGGGAAGGGAGAATATGG + Intergenic
1151137158 17:71957732-71957754 CATGGTGGCAGGAGAGAAGCTGG - Intergenic
1151155970 17:72123249-72123271 GGGTGGGGGAGCAGAGAAGAAGG - Intronic
1151412566 17:73941004-73941026 CAGGGTGGGATGAGAGGAAAGGG + Intergenic
1152132993 17:78488476-78488498 CCCTATGGGAGCAGAGAAGAGGG - Intronic
1152233690 17:79127395-79127417 CGGTGAGGGAGGAGAGGAGGTGG + Intronic
1152626887 17:81391910-81391932 CAGAGGGGGAGGAAAGGAGAGGG - Intergenic
1152891882 17:82886684-82886706 CAGAGTGGGAGGGGAGGGGAGGG - Intronic
1153092707 18:1366593-1366615 AAGTGTGGAGGGAGAGAAGGAGG - Intergenic
1153228442 18:2915028-2915050 GAGCGTGAGAGGAGAGGAGAGGG - Exonic
1154026864 18:10716188-10716210 CAGAGGTGGAGGAGAGAAGGTGG - Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154354162 18:13612072-13612094 CAGTGTGGAAGGACCGGAGAGGG - Intronic
1155016282 18:21843934-21843956 CAGGGTTGGAGAAGAGTAGAAGG + Intronic
1155276447 18:24192548-24192570 CAGACTGGGAGAAGAAAAGAAGG + Intronic
1155618938 18:27753643-27753665 CAGTGTATGAGAAGAGAAGGAGG - Intergenic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1156076771 18:33288328-33288350 CAGGAGGGGAGGAGAGAGGAGGG - Intronic
1156302980 18:35851622-35851644 GAATGTGGGAGGTGAGATGAGGG + Intergenic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1156978201 18:43251866-43251888 CAGGGATGGAGGAGAGAAGTGGG + Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157876216 18:51276137-51276159 GAGTCTGGGTGGAGACAAGATGG + Intergenic
1158586268 18:58738103-58738125 GAGTGGGGGAAGGGAGAAGAGGG - Intronic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1159561190 18:69996665-69996687 CAGTGTGGGAAAACAGAAGCAGG - Intergenic
1159693847 18:71528133-71528155 CAGTATGGAAAGAGAGAAAACGG - Intergenic
1159737547 18:72119417-72119439 CAGTGTGGTAGGACAGTGGAAGG - Intergenic
1159994897 18:74955071-74955093 CAGTGTTTGAGGGGAGAGGAAGG + Intronic
1160088791 18:75806506-75806528 GAGAGAGAGAGGAGAGAAGAGGG + Intergenic
1160095263 18:75865999-75866021 CACTGTGGGTGAAGAGAAGGTGG + Intergenic
1160523591 18:79522720-79522742 CAGATTTGGAGGAGAGAGGACGG + Intronic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1161625556 19:5324538-5324560 CAATGGAGGAGGAGAGGAGAAGG + Intronic
1161635007 19:5382706-5382728 CAGTGAGGAAAGAGAGAGGAAGG - Intergenic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162327927 19:10009626-10009648 CAGGGAGGGAGGGGAGGAGATGG + Intronic
1162756424 19:12863286-12863308 CAGAGGAGGAGGAGAGAAGGGGG + Intronic
1162969160 19:14169787-14169809 CATTGTGGGAGGAGAAGGGAAGG + Intronic
1163025373 19:14508019-14508041 CAGTGGGGCAGGAGAGACAACGG - Intergenic
1163779708 19:19239911-19239933 GAGGGAGGAAGGAGAGAAGAGGG - Intronic
1164246700 19:23436269-23436291 TAGGGTGGGAGGAGCCAAGATGG - Intergenic
1165106111 19:33470496-33470518 CAGGGTGGGAGGGTAGAAGGGGG - Intronic
1165764298 19:38341115-38341137 GAGTGTGGGAGGAGAGGTCAGGG + Intronic
1165790705 19:38490039-38490061 CCGTGTGGGAGGAGAGATGGAGG - Intronic
1166460728 19:42985739-42985761 CAGAGTGGGGGCTGAGAAGATGG + Intronic
1166654398 19:44599609-44599631 CAGTCTAGGAGAAGAGCAGAGGG + Intergenic
1166766376 19:45253981-45254003 AAGAGTTGGAGGAGAGAAAAGGG - Intronic
1167101065 19:47404607-47404629 CAGAATGGGAGGAGTGAAGCAGG - Intronic
1167272242 19:48511926-48511948 AAGGGTGGGAGGAGGGAGGATGG + Intronic
1167290052 19:48619533-48619555 CAGTGTTGGAGGTGAGGAGGCGG + Exonic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167622860 19:50568618-50568640 AAGGGGGGGAGGAAAGAAGAGGG + Intergenic
1167623445 19:50571126-50571148 CAATTAGGGAGGAGAGAAGTTGG + Intergenic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1167799240 19:51729626-51729648 AAGAGGGGGAGGAGAGAAGTTGG + Intergenic
1168259035 19:55182604-55182626 AGGTTTGGGAGGAGTGAAGAAGG - Intronic
1168357688 19:55712777-55712799 GAATGAGGGAGGAGGGAAGAAGG + Intronic
925969403 2:9096218-9096240 AAGTGAGGGAGGGGAGGAGAAGG + Intergenic
926309075 2:11661567-11661589 CAGTGTTGTAGGAGGGAAAATGG + Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926753436 2:16217754-16217776 GAGGGAGGGAGGACAGAAGAGGG + Intergenic
926843540 2:17108219-17108241 CAGTGAGGGAAGAGAAGAGATGG + Intergenic
926991215 2:18682555-18682577 AAAAATGGGAGGAGAGAAGAAGG + Intergenic
927107351 2:19839624-19839646 TGGTGTGGGTGGAGAGAAGGGGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927248008 2:20973550-20973572 CAGGGTGGGAGGAAATAAGCAGG + Intergenic
927494633 2:23544173-23544195 CCGTCTGTGGGGAGAGAAGACGG + Intronic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929554954 2:42920466-42920488 GGGGGTGGGAGGACAGAAGAAGG - Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
929951936 2:46418464-46418486 CAGGATGGGAGGAGCCAAGATGG + Intergenic
930246591 2:48989958-48989980 CAGGGAGGGAGGAGAGAAAGAGG - Intronic
930588725 2:53301298-53301320 GATTGTGAGAGGAGAGAATAAGG + Intergenic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932373769 2:71216258-71216280 AAGTGATGGGGGAGAGAAGAAGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
932852699 2:75201654-75201676 CCCTGAGTGAGGAGAGAAGAGGG + Intergenic
933472652 2:82746642-82746664 CAGCGTGGGAGAAGGGAAGGGGG - Intergenic
933689437 2:85168398-85168420 AAGTGTGGGAACAGTGAAGATGG + Intronic
934110428 2:88737069-88737091 CAGAATGAGAGGAAAGAAGAGGG - Intronic
934783041 2:96985142-96985164 CAGCGTGGGAGGGGATATGAAGG + Intronic
934868987 2:97842555-97842577 CAGTGTTGGGGGAGAGTGGAGGG + Intronic
935111035 2:100094548-100094570 CAGAGTGGGAGGTGAGTGGATGG - Intronic
935507604 2:103925524-103925546 CACTGTGGGAGCACAGAAAAAGG - Intergenic
935671361 2:105559754-105559776 CAGTGAGGGAAGAGAGGGGAGGG - Intergenic
935861298 2:107332961-107332983 CACTGTGGGAGGATGGAACACGG + Intergenic
936123942 2:109770614-109770636 CAGAGTGGGAGGTGAGTGGAGGG + Intergenic
936220747 2:110600850-110600872 CAGAGTGGGAGGTGAGTGGAGGG - Intergenic
936540815 2:113349523-113349545 CTGTGTGGGGGTAGAGCAGATGG - Intergenic
936768938 2:115888336-115888358 CAGGGTGAGAGGAAAGGAGAAGG - Intergenic
937018712 2:118631294-118631316 CAATGTGTGAGGAGAAAACAGGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938044204 2:128102074-128102096 TAGTGCGGGAGGAGAGAAGGGGG - Intronic
938064284 2:128272658-128272680 GAGACAGGGAGGAGAGAAGAGGG + Intronic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938375227 2:130800519-130800541 CAGGGTGGGAGGAGCCAAGAGGG + Intergenic
938643884 2:133311379-133311401 CAGTGTGCCAGGAGAGAGCATGG - Intronic
938659486 2:133471020-133471042 CAGGGGGGGAGGAGCCAAGATGG - Intronic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939383381 2:141465305-141465327 GAGTGTGAGGGGAGAGAAAAAGG + Intronic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
941463967 2:165803179-165803201 GTGTGTGGGAGGAGACAACAGGG + Intergenic
941653067 2:168114394-168114416 CAATGAGGGAAGGGAGAAGAAGG + Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
942294870 2:174507550-174507572 CATTGCTTGAGGAGAGAAGAGGG + Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942742450 2:179195939-179195961 GAATGTGGGAGGAGCCAAGATGG + Intronic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
943219162 2:185082562-185082584 CATGGTGGCAGGAGAGAAGGCGG - Intergenic
944103536 2:196054838-196054860 CATGGTGGCAGGAGACAAGAGGG - Intronic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944297268 2:198080522-198080544 CAGGTTGGGAGGAGGGGAGATGG - Intronic
944606847 2:201359456-201359478 TATTGTGTAAGGAGAGAAGAGGG + Intergenic
944818959 2:203409635-203409657 AAGTGTGGGAAGAGAGTAGTTGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945867416 2:215191686-215191708 CAGGATGGGAGGAGAGAGGGAGG + Intergenic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946804722 2:223460773-223460795 GAGTGCAGGAGAAGAGAAGAGGG + Intergenic
946993247 2:225359913-225359935 CAGGGTGGGAGGTGTGCAGAGGG - Intergenic
947009189 2:225547089-225547111 TTGTGTGGGAGGGGAGGAGAGGG - Intronic
947130964 2:226924412-226924434 CAGTGCTTGAGGAGAGAAAACGG - Intronic
948080837 2:235203849-235203871 CAGGTTTGGAGGAGAGCAGACGG + Intergenic
948192199 2:236068380-236068402 CAGTGCCAGAGGAGAGGAGAGGG - Intronic
948218357 2:236249264-236249286 CATTGTGGGAGGAGAGCAGAAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168970878 20:1929984-1930006 GACTGTGGGAGGAGGGAAGGGGG - Intronic
1169106431 20:2999592-2999614 CAGTTTGGGTGGGGAAAAGATGG + Intronic
1170042465 20:12052948-12052970 GACAGTGGGAGGAGAGGAGAAGG - Intergenic
1170268743 20:14499732-14499754 GAGGGAGGGAGGACAGAAGACGG - Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170764558 20:19279146-19279168 CACTGTGGAAGTAGAGGAGAGGG + Intronic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1171200062 20:23233515-23233537 GAGTGTGCGAGGAGAGGTGAGGG + Intergenic
1172019194 20:31900912-31900934 CAGTGTGGGAGCCCAGAAGCAGG + Intronic
1172596456 20:36154300-36154322 GGGAGGGGGAGGAGAGAAGAGGG - Intronic
1172641512 20:36443063-36443085 CTTTCTGGGAGGAGAGAGGAGGG - Intronic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172832311 20:37846299-37846321 AAGTGAAGGGGGAGAGAAGAGGG + Intronic
1172870190 20:38130972-38130994 CTGTGTGGGAGATGAGAGGAGGG + Intronic
1173002061 20:39111689-39111711 AAGAGTGGGAGGATAGAAAACGG + Intergenic
1173321755 20:41993716-41993738 CAGTGTGGAAAGCAAGAAGAAGG - Intergenic
1173349753 20:42233927-42233949 CAGTGTGAAAGGACAGAGGATGG - Intronic
1173657374 20:44709658-44709680 GACTGAGGGAGGAGGGAAGAAGG + Intergenic
1173828659 20:46063822-46063844 TGGTGTGGGGGGAGAGATGAAGG + Intronic
1173850258 20:46213248-46213270 CAGTGGGGGAGGGGACAAGGGGG + Intronic
1173896839 20:46557578-46557600 CAATGTGGGAGGAAGGGAGAAGG - Intergenic
1174311214 20:49656168-49656190 CAATGTGGCAGGTGAGAGGAGGG - Intronic
1174702440 20:52622600-52622622 AAGTGTGGGAGAAAAGGAGATGG - Intergenic
1175108105 20:56628724-56628746 CCGGGCGGGAGGAGAGAGGAAGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175319943 20:58078505-58078527 GGGTCTGGGAGGAGAGGAGAGGG + Intergenic
1175658432 20:60792100-60792122 CAGGAGGGGAGGAGAGGAGAAGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176264792 20:64203547-64203569 GAGGGAGGGAGGAGGGAAGAGGG - Intronic
1176383989 21:6127889-6127911 GAGGGAGGGAGGAGAGAGGAGGG + Intergenic
1176688091 21:9872838-9872860 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1176968089 21:15234435-15234457 GAGGGTGGAACGAGAGAAGAGGG + Intergenic
1176999881 21:15599080-15599102 CAGTTTCAGAGGAGAGGAGATGG + Intergenic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1177277443 21:18931381-18931403 CAGTATGGAAAGAGAGAAGCAGG + Intergenic
1177493501 21:21858997-21859019 CACTGTGAGAGAAGAAAAGAAGG + Intergenic
1177741364 21:25158064-25158086 AAGTGTGGGGAGAGAGAAAAAGG + Intergenic
1177957232 21:27613931-27613953 GAGGGTGGAAGGAGGGAAGAGGG - Intergenic
1178093733 21:29191760-29191782 CACTGTGGGAACAGACAAGAGGG + Intergenic
1178284137 21:31310803-31310825 CAATGCAGGATGAGAGAAGAAGG + Intronic
1178341675 21:31790750-31790772 CAGAGTAGGAGGGGAGCAGAGGG - Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1178427754 21:32492370-32492392 CAGGATGGGAGGAGAGATGCAGG + Intronic
1178547857 21:33508466-33508488 AAGTGTGGGAGAAGAGGTGAGGG - Intronic
1178703214 21:34851749-34851771 CAATGTGGGAGCAGAGAAGAGGG - Intronic
1178902608 21:36609367-36609389 CAGTGTGGGAGGAGTGAACTGGG - Intergenic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1179251263 21:39673484-39673506 CATTGTGGGAGAGGAGATGATGG - Intergenic
1179570658 21:42276853-42276875 CAGTGTGGAAGCAGAACAGACGG - Intronic
1179739485 21:43410349-43410371 GAGGGAGGGAGGAGAGAGGAGGG - Intergenic
1179770205 21:43609674-43609696 AAGTGGGGGAGGTGAAAAGAGGG + Intronic
1180172054 21:46064756-46064778 GAGGGAGGGAGGAGGGAAGAAGG + Intergenic
1180182341 21:46123582-46123604 AAGAGTGGGTGGATAGAAGATGG + Intronic
1180244936 21:46540559-46540581 GAGTGGGGCAGGTGAGAAGAGGG - Intronic
1180615282 22:17122006-17122028 CTGCCTGGGAGGAGAGACGAGGG + Exonic
1180790911 22:18575084-18575106 CAGGCTCGGAGGAGACAAGAAGG + Intergenic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181020722 22:20100805-20100827 CAGTGTGGGAGGATCGGAGTAGG - Intronic
1181230824 22:21420230-21420252 CAGGCTCGGAGGAGACAAGAAGG - Intronic
1181247823 22:21514639-21514661 CAGGCTCGGAGGAGACAAGAAGG + Intergenic
1181797635 22:25321420-25321442 AGGTGTGGGGGGAGAGAACAGGG + Intergenic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182649940 22:31843446-31843468 AAGATTGTGAGGAGAGAAGAAGG + Intronic
1182756119 22:32681112-32681134 AAGTGAGGGAGGAGAGAGTATGG + Intronic
1182939677 22:34263605-34263627 CCTTGTTGGAGGAGAGAATAAGG - Intergenic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183414044 22:37672611-37672633 CAGCCTGGGAAGAGACAAGAAGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183818877 22:40327741-40327763 GAGTGTGGTAGAAGAGAAGAAGG - Exonic
1183837065 22:40463298-40463320 CAGAGAGAGAGGAGAGATGAGGG + Intronic
1184345536 22:43910405-43910427 CAGTCTGGAAGCAGAGGAGAGGG - Intergenic
1184383615 22:44161824-44161846 CAATGGGGGAGGAGTGAGGACGG - Intronic
1184635357 22:45824176-45824198 CAGTGTGGGATATTAGAAGAGGG - Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949401100 3:3665955-3665977 GAGGGAGGGAGGAGAGAAGGAGG + Intergenic
949429752 3:3963071-3963093 GAGTCTGGGAGGAGCCAAGATGG + Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949924596 3:9031293-9031315 AAGTCTTGGAGGAGAGAGGAGGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950462878 3:13135647-13135669 CGGAGTGGGTGGAGAGAAGGGGG + Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950656251 3:14438706-14438728 CAGTTTGGGATGGGAGAAGCAGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950975565 3:17239243-17239265 CATTGTGGCAGGTGAAAAGACGG - Intronic
951037897 3:17953405-17953427 CACTGTGTCAGGAGAAAAGAGGG - Intronic
951572958 3:24084556-24084578 CATTGTCGGAGGAGCCAAGATGG - Intergenic
951783506 3:26390749-26390771 CAGTGGGGGAGGAGCCAAGATGG - Intergenic
951849921 3:27127885-27127907 GAGGGGAGGAGGAGAGAAGAAGG - Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
952849677 3:37717565-37717587 CATGGTGGCAGGAGAGAAGGGGG + Intronic
953129885 3:40127727-40127749 CAGGGAGGTAGGAGAGCAGAAGG + Intronic
953160601 3:40415926-40415948 CTTCGTGGCAGGAGAGAAGATGG + Exonic
953273866 3:41475870-41475892 CAGGAAGGGAGGAGAGAAGGAGG + Intronic
953336397 3:42098037-42098059 GAGAGATGGAGGAGAGAAGAGGG - Intronic
954425441 3:50440633-50440655 CAGTGTGGGAGCAGAGAGGAGGG + Intronic
954497563 3:50979154-50979176 CACTGGGGGAGGAGCCAAGATGG - Intronic
954672877 3:52299884-52299906 CAGGGAGGGAGGAGAGAAGTGGG + Intergenic
954959085 3:54548853-54548875 GAGTGAGGAAGAAGAGAAGATGG - Intronic
955386942 3:58487805-58487827 CAGTGTGGGAGGGCACAACAAGG - Intergenic
955535423 3:59918355-59918377 AAGTGTGGGAGGTGTTAAGAAGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
955978030 3:64496939-64496961 CAGTGGTGGAGGCCAGAAGATGG - Intergenic
956307652 3:67843692-67843714 CCATGTCAGAGGAGAGAAGAGGG + Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958112822 3:89172032-89172054 TGGTGGGGGAGTAGAGAAGAAGG - Intronic
960435136 3:117617179-117617201 CAGTGTTGGAAGTGAGAAAAGGG + Intergenic
960948643 3:122984130-122984152 CAGTGAAGGAGAAGAGAAGAAGG - Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961541748 3:127604830-127604852 GAGTCTGGGAGGGGAGTAGAAGG + Intronic
961635713 3:128331215-128331237 CACTGAGGAAGGGGAGAAGAGGG - Intronic
961902203 3:130224054-130224076 CAGTGTGGGAGGAAAGGCGCCGG - Intergenic
962152971 3:132912476-132912498 GAGTGTGGCAGGCAAGAAGAAGG - Intergenic
962684570 3:137834831-137834853 GGGTCTGGGAGGAGAGAAGAGGG - Intergenic
962730008 3:138273312-138273334 CAGTGTAGGAGTGGAGAATAGGG - Intronic
962841683 3:139238445-139238467 CACAGGGGGAGGAGAGAAGACGG - Intronic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963727655 3:148940049-148940071 GATTGTGGGAGGTGAGAATAAGG - Intergenic
963971004 3:151429437-151429459 CAGACCAGGAGGAGAGAAGAGGG + Intronic
963975218 3:151472887-151472909 CAGTGTGGGTGGTGAGAACTTGG - Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964214917 3:154268568-154268590 CAGGGTGGGGGAAGAGAGGAGGG + Intergenic
965571940 3:170181712-170181734 TAGTGATGGAGGAGAGAAGATGG - Exonic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966052118 3:175632049-175632071 AAATATGGGAGGAAAGAAGATGG + Intronic
966266391 3:178049638-178049660 CAGTGTGTGAGAAGTGAAAATGG - Intergenic
966311059 3:178594371-178594393 TAGTGTGGAAGCAGTGAAGATGG + Intronic
966420836 3:179732814-179732836 CAGTGGGGGAAGAGAGACAAGGG - Intronic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
966736910 3:183194099-183194121 GAGTGTGGGGGCAGAGAGGAGGG + Intronic
966740385 3:183227349-183227371 AAGTCTGGGAGGTGGGAAGAAGG + Intronic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
967232862 3:187357092-187357114 GAGTGTGGCATGAGATAAGAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968616152 4:1578785-1578807 GAGGGGGAGAGGAGAGAAGAGGG + Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969832171 4:9806675-9806697 GGGGGTGGGAGGAGAGAAGTGGG + Intronic
969976303 4:11105474-11105496 CGGGGTGGGAGGAGGGGAGAAGG + Intergenic
969984775 4:11196987-11197009 CAGTGTGGGAGAAGAGAAAGAGG + Intergenic
970049673 4:11899064-11899086 GAGTATGGAAGGAGAGACGATGG - Intergenic
970158439 4:13165190-13165212 CAGTGGGGGAGGTCAGAATAAGG - Intergenic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970257422 4:14183163-14183185 CCATGTGGGAGGAAAGAGGAGGG - Intergenic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
970689735 4:18608817-18608839 GAGGGTGGGAGGAAAGAAGCAGG - Intergenic
970894438 4:21086005-21086027 CAGTGAGGGAGCAGAGGAAATGG - Intronic
970959013 4:21851175-21851197 CAGGGAGGGAGGAGAGGAGAGGG + Intronic
972511415 4:39771167-39771189 CCGTGTAGCAGGAGAGAAGCAGG + Intronic
972995903 4:44879455-44879477 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
973333582 4:48933998-48934020 CCGTGTTGGAGGAGAGAGGGAGG - Intergenic
973604986 4:52577775-52577797 CAGCATGGGAGGATAGAAGGAGG + Intergenic
973808064 4:54544640-54544662 CAGTGTGGGAAGAGAAAGAAGGG - Intergenic
974042053 4:56865911-56865933 CAGAGTGGGAGCAAAAAAGAGGG + Intergenic
974133295 4:57783471-57783493 AAGGGTGGGAGGAGGGATGAGGG - Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
975114696 4:70666920-70666942 AAGTGAAGGAGGAGAGATGAAGG + Intronic
975281473 4:72568047-72568069 CAGAGGGGGAGGGGAGAAGGCGG + Intronic
975837036 4:78434234-78434256 CAATGTTGGAGGAGACAAAAAGG + Intronic
976037807 4:80845257-80845279 CAGTGTGGGACTTGAGCAGATGG - Intronic
976069302 4:81223045-81223067 CAGATTGGGAGGAGCAAAGAGGG + Intergenic
976722907 4:88187147-88187169 TAGTGTGGCAGGGGAGAAGTGGG + Intronic
977130947 4:93236347-93236369 CAGTGTGGGAAGAAAGAACCTGG - Intronic
977214183 4:94259499-94259521 CTGTGTGGGAGGGGAGAGGTAGG + Intronic
977305413 4:95318062-95318084 CAGCCTGGGAGGACAGCAGAGGG + Intronic
977760233 4:100726185-100726207 CAATGTCTGAGGACAGAAGATGG - Intronic
978209576 4:106119949-106119971 CAATGTGAGAGGAGCCAAGATGG + Intronic
978243754 4:106548706-106548728 AAGAGAGGGAGGAGAGTAGAGGG - Intergenic
978360227 4:107923725-107923747 CAGTGGGGGAAGACAAAAGATGG - Intergenic
978381749 4:108135830-108135852 GTGCGTGGGAGGAGAGCAGAAGG - Intronic
978396309 4:108284099-108284121 AGGTCAGGGAGGAGAGAAGAGGG + Intergenic
978606403 4:110484875-110484897 GTGTGTGGGAGGTGAGAGGAAGG - Intronic
978839169 4:113189294-113189316 CTCTGTGGGAAGAGAGAGGAGGG - Intronic
979132912 4:117070898-117070920 CAGAGAGGGAGGAGAGAAAATGG - Intergenic
979270841 4:118759741-118759763 GTGGGTGGGAGGAGAGAAGTTGG - Intronic
979926067 4:126566211-126566233 AAGAGCGGGAAGAGAGAAGAGGG + Intergenic
980082942 4:128363532-128363554 GAGTGTGCAAGAAGAGAAGAAGG + Intergenic
980219987 4:129901794-129901816 CAGTATGTGAGGGGAGAAAAAGG - Intergenic
980351462 4:131690677-131690699 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
980777985 4:137461593-137461615 CAGTGAGGGATGATAGAAGTGGG + Intergenic
980888953 4:138793636-138793658 GAGGGAGGGAGGAAAGAAGAAGG + Intergenic
981454899 4:144941856-144941878 CAGGCTGGAAGAAGAGAAGAGGG - Intergenic
981609686 4:146579959-146579981 CTCTGAGGGAGGTGAGAAGAGGG + Intergenic
981771213 4:148310871-148310893 GAGTGTGGGAGGAGAGAAACTGG - Intronic
981774921 4:148355444-148355466 CAGTGTGGGAGTGGGGTAGAGGG - Intronic
981990033 4:150907283-150907305 GAGGGAGGGAGGAGAGAAGTGGG + Intronic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982671067 4:158320565-158320587 CAGAAGGGGAGAAGAGAAGAAGG - Intronic
982942925 4:161581363-161581385 CACAGTGGGAGGAGAAGAGAGGG + Intronic
983020241 4:162667600-162667622 AAGTGTGTGAGGGGAGAAAATGG + Intergenic
983093349 4:163533335-163533357 CAGTTTAGGAGGAGAAAGGAAGG + Intronic
983578948 4:169288375-169288397 CAGTGTGGGGGCGGGGAAGAAGG + Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983669291 4:170216895-170216917 CAGTTTCTGAGGTGAGAAGAGGG + Intergenic
983892448 4:173044351-173044373 GAGGGTGGAAGGTGAGAAGAGGG + Intergenic
984532346 4:180932443-180932465 GAGAGAGGGAGAAGAGAAGAGGG - Intergenic
984614284 4:181878335-181878357 AAGGAAGGGAGGAGAGAAGAGGG + Intergenic
985259188 4:188099145-188099167 CCGTGTGGGGAGAGAGAACATGG - Exonic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985883120 5:2655899-2655921 CAGTTTGGAAGGAGAGATGATGG + Intergenic
985966765 5:3343647-3343669 CAGGGTGGGGGGAGAGAGAAGGG - Intergenic
986644867 5:9907120-9907142 CAGCAAGGAAGGAGAGAAGAGGG - Intergenic
987384679 5:17318049-17318071 TAGTTTGGGAGGAGAAAAGATGG + Intergenic
988088456 5:26503249-26503271 GAGTCAGGGAGGAGAGGAGATGG - Intergenic
988149452 5:27358050-27358072 AAGTGTTGAAGGAGAGAATAAGG - Intergenic
988708957 5:33754458-33754480 CTGGGTGGGAGAAGAGCAGATGG - Intronic
988785021 5:34558491-34558513 AAGAGAGGAAGGAGAGAAGAAGG + Intergenic
989003961 5:36789225-36789247 AAAGGAGGGAGGAGAGAAGATGG - Intergenic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990723707 5:58729088-58729110 TAGTGTGGGTGCAGAGATGAGGG - Intronic
991145015 5:63291172-63291194 CAGAGTAGCAGGAAAGAAGAGGG - Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991471655 5:66975565-66975587 CACTGTGGCAGGAGAGATTAAGG + Intronic
992323256 5:75635261-75635283 CCTCATGGGAGGAGAGAAGAGGG - Intronic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
992415498 5:76548943-76548965 CAGACTGGGATGGGAGAAGAAGG + Intronic
992736835 5:79730199-79730221 CAGTGTCAAAGGAGAGAAGGAGG + Exonic
993151435 5:84167407-84167429 CAGTATGTGAGGTGAGAAGCAGG - Intronic
993802016 5:92353543-92353565 AAGTGTTGGGGGAGAGGAGAAGG + Intergenic
994331637 5:98513223-98513245 CACTATGGGAGGACAGAAGGAGG + Intergenic
994592182 5:101787717-101787739 CAGAGTAGGAGGAGAGCAAAGGG - Intergenic
994618072 5:102131353-102131375 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
995745349 5:115396247-115396269 CACTGTGGGAGGGAAGATGAAGG + Intergenic
996348775 5:122515621-122515643 CACTGGGGGAGGAGCCAAGATGG - Intergenic
996813401 5:127545015-127545037 TACTGTGGGAGGAGCCAAGATGG - Intronic
996850318 5:127944070-127944092 CAGGGTTGGAGGAGAGGGGATGG + Intergenic
997127409 5:131241652-131241674 AAGTCTGGGAGGTGAGAAGGGGG - Intergenic
997405581 5:133644126-133644148 CACTGTGCTAGGAGAAAAGAAGG + Intergenic
997530111 5:134576770-134576792 CGGTCTGGGAGGAGAGCAAAGGG + Intronic
997641739 5:135452877-135452899 CAGTTTGGAAGGGGTGAAGATGG + Intergenic
997644194 5:135469234-135469256 CAGTTTGGAAGAAGAGAAGAGGG + Intergenic
997827794 5:137123188-137123210 CAGTGTTGGAGGAGAGGAGACGG + Intronic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998430320 5:142064776-142064798 CACTGTGGAAGGAGAGGGGAGGG - Intergenic
999075081 5:148788027-148788049 GAGTGTGGGAGGAGAGACAAAGG - Intergenic
999089305 5:148921359-148921381 GAATGTGGAAGGAGAGAAGGAGG + Intergenic
1000390231 5:160715623-160715645 GAGAGTGGGAGGAGCCAAGATGG - Intronic
1000672404 5:164078742-164078764 CACTGTGGCAGGAGAGAAGCAGG - Intergenic
1001691785 5:173638774-173638796 CAGTCGGGAAGGAGAGAGGAAGG - Intergenic
1001853529 5:174990517-174990539 CAGTAATGGAGGAGAGAGGATGG + Intergenic
1002719836 5:181251760-181251782 CAGGGTCTGAGGAGAGGAGATGG - Intergenic
1003277893 6:4667847-4667869 GTCTGTGGGAAGAGAGAAGAAGG - Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003410924 6:5862362-5862384 GAGAGTGGGAGGGGAGAAGCTGG + Intergenic
1004201860 6:13555930-13555952 CAGAGTGGGGGGAGAGGAGCTGG + Intergenic
1004279439 6:14268507-14268529 AAGTGTTGGAGGGGAGGAGAAGG + Intergenic
1004484778 6:16056047-16056069 CAGTGCTGGAGGAATGAAGATGG + Intergenic
1004612082 6:17251825-17251847 GAGAGTGGGAGGAGAGAACATGG - Intergenic
1004859976 6:19793902-19793924 AAGGGAGGGAGGACAGAAGAAGG + Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1006059570 6:31410367-31410389 GAGGGTGGGAGGATAGAGGAGGG - Intronic
1006072059 6:31505438-31505460 GAGGGTGGGAGGATAGAGGAGGG - Intronic
1006141170 6:31930956-31930978 CCTTGTGGGAGGGGACAAGAGGG - Intronic
1006385683 6:33729508-33729530 GAGGGTGGGAGGAGAAAGGATGG + Intronic
1006667616 6:35707690-35707712 GAGGGTGGGAGGAGAGAGAAGGG - Intronic
1006702556 6:35987706-35987728 CAGCAGGGGAGGAAAGAAGAGGG + Intronic
1006728587 6:36218101-36218123 GAGTGGGGGAAGAGAGAAAAAGG - Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007314342 6:40973422-40973444 GAGAGTGGAAGAAGAGAAGAGGG - Intergenic
1007400100 6:41598569-41598591 GGGTTGGGGAGGAGAGAAGAGGG - Intronic
1007428779 6:41764345-41764367 AAGTGTGTGAGGTGACAAGATGG - Intergenic
1007756112 6:44100885-44100907 AAGTGAGGGAGGAGAGAAGGTGG - Intergenic
1008971332 6:57372596-57372618 GAGGGTGGGAGGTGAGAGGAGGG - Intronic
1009160292 6:60274398-60274420 GAGGGTGGGAGGTGAGAGGAGGG - Intergenic
1009386270 6:63086461-63086483 TAGTGTGGAAGGGGACAAGAGGG + Intergenic
1011066595 6:83333949-83333971 CAGGGGGGGAGGAGCCAAGATGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011335943 6:86259787-86259809 CAGCCTGGGAGGAGTGGAGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012004157 6:93691801-93691823 CATTTTGGGAGGAGAGACAAAGG + Intergenic
1012156509 6:95825762-95825784 GAGTGTGGGAGGTGGGAGGAGGG + Intergenic
1012269492 6:97191127-97191149 CTGTGTGGGAGTAGAGAGGTGGG - Intronic
1012626953 6:101416299-101416321 CCGTGTTAGAGGGGAGAAGAAGG + Intronic
1012918289 6:105194717-105194739 CAGGGTGGGATGAGAGAATGTGG + Intergenic
1013356768 6:109352081-109352103 CAATGTGAGGTGAGAGAAGAAGG - Intergenic
1014070995 6:117181812-117181834 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015868844 6:137755300-137755322 AAGGGTGGGAGGAGGAAAGAAGG + Intergenic
1016705528 6:147102440-147102462 GAGGGTGGGAGGAGAGAAGTGGG - Intergenic
1016713198 6:147196578-147196600 CAGTCTAGGAGGTGAGATGAGGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1016758579 6:147713817-147713839 GAGTAAGGGAGGAGAGAAGAGGG - Intronic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1018071827 6:160171434-160171456 CAGTCTGGAATGAGAAAAGATGG + Intronic
1018209735 6:161469290-161469312 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1018238888 6:161753420-161753442 CAGGTTGGAAAGAGAGAAGAAGG + Intronic
1018254908 6:161908367-161908389 CAATCTGGCAGGAGAGGAGAAGG - Intronic
1018373718 6:163191720-163191742 CTGAGTGGGAGTGGAGAAGATGG - Intronic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1019127304 6:169849391-169849413 GAATGTGGGAGAAGAGAAGGAGG - Intergenic
1019532720 7:1511687-1511709 CACTGCGGGAGGAGAGAAGTGGG - Intergenic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1020258226 7:6514585-6514607 CAGAGTGGGGGTAGACAAGACGG + Intronic
1020488546 7:8749603-8749625 CAGTGTGGAAGGAGACTGGAGGG + Intronic
1020618944 7:10495842-10495864 TGGTGTGGGAGGAGCCAAGATGG + Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020916750 7:14203962-14203984 CGCTGGGGGAGGAGAGAATAGGG - Intronic
1021183302 7:17533606-17533628 CAGAGTGGGAGGATGGGAGAAGG - Intergenic
1021864324 7:24939836-24939858 GAGGGTGGGAGGAAAGAGGAGGG + Intronic
1022135659 7:27445677-27445699 GAGTGAGGAAGGGGAGAAGAGGG + Intergenic
1022180297 7:27912558-27912580 CAGAGAGGGAGGAAGGAAGAGGG + Intronic
1022223823 7:28342278-28342300 CGGTGTGGAAGGATAGATGAGGG + Intronic
1022765690 7:33408572-33408594 AAATGTGGGAGGAGCCAAGATGG - Intronic
1022804839 7:33811303-33811325 CCATGAGGGAGGATAGAAGATGG - Intergenic
1023084754 7:36559110-36559132 AAATGTGGGAGGAGCCAAGATGG - Intronic
1023201146 7:37698312-37698334 CATGGTGGTAGGAGGGAAGAAGG - Intronic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1024120624 7:46234971-46234993 CACTATGGTAGGAGAGAATAAGG + Intergenic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1024350193 7:48355644-48355666 CAGTGTGGTAGCAGAGAAGCTGG + Intronic
1024449726 7:49525393-49525415 CACTGTGAGAGAAGAGGAGAAGG + Intergenic
1024457845 7:49629501-49629523 CAGGGAGGGAGGAAAGAACATGG - Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025107621 7:56185266-56185288 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1025624240 7:63205253-63205275 ATGTGTGGGAGGTGAGAGGAAGG - Intergenic
1026004646 7:66591605-66591627 CCGTCTGGGAGGAGAGCCGAGGG - Intergenic
1026025643 7:66741416-66741438 CCGTCTGGGAGGAGAGCCGAGGG + Intronic
1026310625 7:69180824-69180846 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1026742373 7:72987069-72987091 CAGAGTGGGAGGAAAGAAAAAGG + Intergenic
1026802220 7:73407500-73407522 CAGAGTGGGAGGAAAGAAAAAGG + Intergenic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1026854386 7:73743323-73743345 AAATCTGGGAGGAGAGAAGCTGG - Intergenic
1026960504 7:74404597-74404619 CACGGTGGGAGGTGAGGAGAGGG - Exonic
1027028495 7:74871806-74871828 CAGAGTGGGAGGAAAGAAAAAGG + Intergenic
1027101362 7:75378008-75378030 CAGAGTGGGAGGAAAGAAAAAGG - Intergenic
1027344867 7:77248269-77248291 AAGGGTGGGAGGACAGAAGGAGG + Intronic
1028226476 7:88257833-88257855 CAGAATGAGAGGAGAGAAAATGG - Intergenic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029192953 7:98784840-98784862 CACTGTGGGAGCACAGATGAGGG + Intergenic
1029357087 7:100060209-100060231 CAGTGTGGGATCAGATGAGAAGG + Intronic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1030034953 7:105401049-105401071 CAGTGACTGAGGAGAGAGGAGGG - Intergenic
1030361534 7:108600150-108600172 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1031044018 7:116866906-116866928 TTGTGTGAGAGGAAAGAAGATGG - Intronic
1031069558 7:117146604-117146626 CAGAGTGGTAGCAGAGAAGGTGG + Intronic
1031145053 7:117988421-117988443 GATTGGGGGAGGAGAGATGAAGG + Intergenic
1031689665 7:124772023-124772045 CAGACTGGGAGAAGAGAAAAAGG + Intergenic
1032151007 7:129429745-129429767 TAGGGAGGGAGGAGAGCAGAGGG - Exonic
1032175087 7:129616852-129616874 GAGTGTTGGTGGGGAGAAGAGGG + Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032768390 7:135023186-135023208 CAATGAAGGAGGAGACAAGATGG + Intronic
1033025974 7:137772919-137772941 CAATGGGGGTGGAGAGAGGAAGG + Intronic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033324359 7:140365128-140365150 CTCAGTGGGAGGAGAGCAGAAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035303179 7:157910995-157911017 CAGAGAGGGAGAAGAGAAGGGGG + Intronic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1036089828 8:5653404-5653426 CAGTGTCTGAGGAAAGGAGAGGG + Intergenic
1036382657 8:8247672-8247694 CAGGGTGGGGGAGGAGAAGATGG - Intergenic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1036546084 8:9771285-9771307 AAGGGAGGGAGGAGAGAGGAAGG + Intronic
1036686478 8:10914844-10914866 CAGCCAGGGAGGAGAGAGGAGGG - Intronic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1036984739 8:13515956-13515978 GAATGTGGAAGGAAAGAAGAGGG + Intergenic
1037104879 8:15094821-15094843 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1037157923 8:15728466-15728488 GAGGGAGGGAGGAGAGAAGGAGG + Intronic
1037742729 8:21620410-21620432 GAGGGTGGGAGGAGAGTGGATGG - Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038165890 8:25084779-25084801 CATTGTAGGAGGAAAGAGGAAGG + Intergenic
1038542601 8:28402193-28402215 CAGCGTCGGTGGAGAGAAGAGGG + Intronic
1038674966 8:29615211-29615233 CACCATGTGAGGAGAGAAGAAGG - Intergenic
1038948751 8:32390676-32390698 CATTGTGGGAGCAGATAAGAGGG - Intronic
1039558617 8:38495331-38495353 CGGTGAGGGAGGCGAGAGGAAGG + Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1039897297 8:41725429-41725451 CAGCCGGGGAGGAGAGATGAAGG + Intronic
1040388499 8:46930821-46930843 CAGTGAGGGAGGGAAGAGGAGGG + Intergenic
1040484453 8:47856753-47856775 TACTCTGGGAGTAGAGAAGATGG + Intronic
1040721573 8:50330493-50330515 CAGTTTGGAGGGTGAGAAGAAGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041659133 8:60384057-60384079 CAGGAGGGGAGGAGAGAGGAAGG - Intergenic
1042367738 8:67955765-67955787 TGGAGTGGGAGGATAGAAGATGG - Intronic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1042750558 8:72153448-72153470 CAGCTTGGGAGGAGCCAAGATGG - Intergenic
1042778654 8:72465652-72465674 AAATGCAGGAGGAGAGAAGAAGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043480453 8:80647357-80647379 GAGGGTGGGAGGAGAGGAGACGG + Intronic
1043666748 8:82825102-82825124 CAGTGTGGGAGGAGCGACCTGGG + Intergenic
1043920615 8:85979342-85979364 CAGTGTCTGAGGGCAGAAGATGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044826945 8:96207850-96207872 CAGCGTGGCAGCAGAGAAGGTGG - Intergenic
1044900299 8:96936977-96936999 CAGAGAGGGAGGAGAGAGGGAGG - Intronic
1045027072 8:98097709-98097731 TGGTGTGGGAAGAAAGAAGAAGG - Intergenic
1045338685 8:101232586-101232608 CAGAGTGGGAGAAGAGGAGTTGG - Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045520744 8:102900853-102900875 AAGGTTGGGAGGAGAGAGGAGGG + Intronic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1045749671 8:105468278-105468300 CAATTTGGGAGCAGAGAAGGAGG - Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046057213 8:109093352-109093374 GAGTGAGGCAGGGGAGAAGACGG - Intronic
1047130104 8:122009294-122009316 CAGAGGGGGAGAAGAAAAGAAGG - Intergenic
1047317528 8:123748152-123748174 GAAGGTGGGAGGAGAGAGGAGGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047840268 8:128744600-128744622 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
1048200218 8:132367156-132367178 CAGGGTTGAAGGAGAGGAGAAGG - Intronic
1048303210 8:133266390-133266412 CCGTGTGGCAGCAGAGAGGAAGG + Intronic
1048550183 8:135426819-135426841 TCGTGTGAGAGGAAAGAAGACGG - Intergenic
1048575824 8:135689268-135689290 AAGTGTGGAAGGAAAGAGGAAGG + Intergenic
1048598921 8:135897760-135897782 CAATGTGCAAGGACAGAAGAGGG + Intergenic
1048991909 8:139765490-139765512 GTGGGTGGGAGGAGAGATGAGGG + Intronic
1049164315 8:141117001-141117023 CAGTGTGGGCCCAGAGAACATGG + Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049302755 8:141880338-141880360 CACTGGGGGAGGGGAGAAGAGGG - Intergenic
1049370373 8:142261398-142261420 GATAGTGGGAGGAGAGAGGAAGG + Intronic
1049377860 8:142297538-142297560 GAATGTGGGAGGAGAGATGAGGG + Intronic
1050237216 9:3594658-3594680 CAGGGTGGCAGGAGAGAGAAGGG + Intergenic
1050457721 9:5849506-5849528 TGGTGTGGGAAGAGAGATGAAGG - Intergenic
1051000686 9:12278674-12278696 CAGTGACTGAGGGGAGAAGATGG - Intergenic
1051095939 9:13465271-13465293 CAGGATGGAAGGCGAGAAGAAGG - Intergenic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051220434 9:14843171-14843193 CAGTGTCAGAGGGAAGAAGATGG - Intronic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1051370516 9:16355282-16355304 GAGTGTGGGAGGTGGCAAGAGGG - Intergenic
1051740307 9:20245179-20245201 TCTAGTGGGAGGAGAGAAGAAGG + Intergenic
1052230536 9:26145643-26145665 CAGGCTTGGAGGAGAGAAGGTGG + Intergenic
1052692749 9:31836099-31836121 CAGGCTGGGAGGTGAGGAGAGGG - Intergenic
1052747023 9:32451018-32451040 CTGTTTGGGAGCAGACAAGAAGG + Exonic
1053781253 9:41609035-41609057 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1054169199 9:61819188-61819210 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1054668333 9:67761628-67761650 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1056024248 9:82476209-82476231 CAGTGAGGGAGGAGAGAGGCAGG - Intergenic
1056258417 9:84823997-84824019 CAGTGGGGGAGGAGCTAAGCAGG + Intronic
1056406009 9:86275799-86275821 CAGGGTGGAAGGAGAAAACAGGG + Intronic
1056446021 9:86666878-86666900 CTTTGTGGTAGGACAGAAGACGG + Intergenic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1056936342 9:90917802-90917824 CAGTGTCCGAGGGCAGAAGATGG - Intergenic
1057047021 9:91893781-91893803 GAGTGTGGCAGGGGAGAGGATGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057918447 9:99075671-99075693 AAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1058151136 9:101464865-101464887 CAGTGTGGGAGGGGAGACTTTGG - Intergenic
1058740666 9:107939237-107939259 CAGTGATAGAGGGGAGAAGAGGG + Intergenic
1059321217 9:113471606-113471628 CAGGGAGGGAGGAGAAAAGGAGG - Intronic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1059732626 9:117072018-117072040 GAGTGGGGGAGGAGCCAAGATGG - Intronic
1059757755 9:117309784-117309806 AAGTGTGGGAGGCAAGCAGATGG + Intronic
1059802378 9:117763466-117763488 CAGCTTTGGAGGAGAGATGACGG + Intergenic
1060030754 9:120212987-120213009 CAGTGTAGGATGACAGAAGGAGG + Intergenic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060202374 9:121658953-121658975 CTGTCAGGGAGAAGAGAAGAGGG - Intronic
1060251092 9:121987367-121987389 GTGGGTAGGAGGAGAGAAGAAGG - Intronic
1060496741 9:124124917-124124939 CAGAAGGGGAGGTGAGAAGAGGG + Intergenic
1060882750 9:127129796-127129818 CAGGGAGGGAAGAGAGAAGGCGG - Intronic
1060884354 9:127140108-127140130 GACTGTGGGAGGAAAGAAAAAGG + Intronic
1060999307 9:127893996-127894018 CAGTGAGGGAAGGAAGAAGATGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061070128 9:128304534-128304556 CAGTGTGGGAAGAGAGGAACTGG + Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061491148 9:130944892-130944914 CAGGTGGGGAGGGGAGAAGAGGG + Intergenic
1061495410 9:130971089-130971111 AAGGGAGGGAGGAGAGAGGAAGG + Intergenic
1061627772 9:131851663-131851685 CAGTGTGCGGGGAGATCAGAAGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061811617 9:133165423-133165445 CAGAGTGGGAGAAGAGCAGTGGG + Intergenic
1062389850 9:136329643-136329665 CAGTGTGGGAAGGCAGTAGACGG - Intronic
1062529946 9:136995406-136995428 CAGGGTGGGAGGGGAAAAGAGGG - Intronic
1185703473 X:2249038-2249060 CAGTGTGATAGGAGAACAGATGG - Intronic
1185891846 X:3828811-3828833 CAGTGTGGAAGAAGATCAGAGGG - Intronic
1185896953 X:3867225-3867247 CAGTGTGGAAGAAGATCAGAGGG - Intergenic
1186121990 X:6373316-6373338 GAGGGTGGGAGGTGGGAAGAGGG + Intergenic
1186624328 X:11276106-11276128 CATTGAGGGAGGAAAGAGGAGGG + Intronic
1186687574 X:11941296-11941318 CAGGGAGGGAGGAGCCAAGATGG - Intergenic
1187144715 X:16626861-16626883 GAATGTGGGAGAAGAAAAGAGGG - Intronic
1187324896 X:18277813-18277835 CAGTGTAATAGGGGAGAAGATGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187596857 X:20782821-20782843 CAGAGTGGGAGAGGAGAAGAGGG + Intergenic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1188268025 X:28102635-28102657 TAGTGTGGGAGGCGGGGAGAGGG - Intergenic
1188361067 X:29254478-29254500 GAGAGAGGGAGGAGAGGAGAAGG + Intronic
1188768532 X:34125951-34125973 CGGTGTGGGAGGTGGGAGGAAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189209085 X:39267654-39267676 CAGTTTGGGAGGAAAGATGATGG - Intergenic
1189446372 X:41085212-41085234 CGGGGTGGAGGGAGAGAAGAGGG + Intergenic
1189468844 X:41298672-41298694 GAGAGGAGGAGGAGAGAAGAAGG - Intergenic
1189583369 X:42430874-42430896 TATTGTGGGAGGAGCCAAGATGG - Intergenic
1189891146 X:45603798-45603820 GAGTGAGGGAGGAAAGAGGAAGG - Intergenic
1190074490 X:47306479-47306501 CATGGTGGGAGGAGAGAGAAGGG - Intergenic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190213875 X:48467648-48467670 CAGTGCGGGAGGAGATTAGCTGG + Intronic
1190272559 X:48877536-48877558 CATGGTGGGAGGAGAGAGAAGGG + Intergenic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1191827197 X:65378593-65378615 GAGTGGGGGAGGAGCCAAGATGG + Intronic
1192236182 X:69297605-69297627 GAGTGAGGAAGGAGAAAAGATGG - Intergenic
1192347265 X:70321235-70321257 CATTCTGGGAGAAGAGGAGATGG - Intronic
1192418828 X:71010362-71010384 GAGTGTGAGAGGAGTTAAGAAGG - Intergenic
1193222725 X:78945765-78945787 GAGAGTGGGACCAGAGAAGATGG + Intronic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195141700 X:101967271-101967293 AAGTGTGGCAGGTGAGAGGAAGG - Intergenic
1195706482 X:107741409-107741431 CAGAGTGGGAGGAGACAATGTGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195778691 X:108437554-108437576 GAGAGTGGGAGGAGAGCACAAGG - Intronic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196713978 X:118793605-118793627 CTGTGTGTGAGGAGAGAAATGGG - Exonic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1196964078 X:121036575-121036597 CAGGGCTGGAGGAGAGAGGAAGG + Intergenic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197971388 X:132118841-132118863 CTGTGGGGGAGCAGAGATGAAGG - Intronic
1198362445 X:135908880-135908902 CAGTGTTCGTGAAGAGAAGATGG + Exonic
1198371204 X:135991220-135991242 CAGGGAGGGAGCAGAGAGGAGGG - Intronic
1198711477 X:139508820-139508842 CAGTGTGGAATGAGAGACAATGG + Intergenic
1199271391 X:145886811-145886833 CAGTCAGGAAGGAGAGAACATGG + Intergenic
1199418917 X:147620243-147620265 CAGCATGGGAGGAAAGATGAAGG - Intergenic
1199540163 X:148949473-148949495 CAGACTGGGGGCAGAGAAGATGG - Intronic
1199615129 X:149649981-149650003 CACTGTCAGAGGAGAGGAGAAGG + Intergenic
1200136506 X:153877674-153877696 TGGTGTGGGAGAAGAGAGGAAGG + Intronic
1200757050 Y:6999822-6999844 AAGGAAGGGAGGAGAGAAGACGG - Intronic
1201017691 Y:9623050-9623072 AATTGTGGGAGGAGACAATAGGG - Intergenic
1201234665 Y:11897539-11897561 CACTGTGGGAGGAGAGGGCATGG - Intergenic
1201550409 Y:15211879-15211901 GAGGGAGGGAGGAAAGAAGAAGG + Intergenic
1201741247 Y:17326303-17326325 AAGTAAGGAAGGAGAGAAGAGGG + Intergenic
1202117406 Y:21482766-21482788 CAGTGGGGGAGGGGAGACAAGGG + Intergenic
1202306214 Y:23473688-23473710 CAGTGTGGAAGGGGGAAAGATGG + Intergenic
1202564595 Y:26196901-26196923 CAGTGTGGAAGGGGGAAAGATGG - Intergenic