ID: 1096911545

View in Genome Browser
Species Human (GRCh38)
Location 12:54989467-54989489
Sequence TTTCCATGGGAGCAGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096911534_1096911545 21 Left 1096911534 12:54989423-54989445 CCCCAACCTTTTGGCATCAAGGA 0: 1
1: 1
2: 40
3: 165
4: 1329
Right 1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG 0: 1
1: 0
2: 5
3: 36
4: 301
1096911535_1096911545 20 Left 1096911535 12:54989424-54989446 CCCAACCTTTTGGCATCAAGGAC 0: 1
1: 1
2: 64
3: 390
4: 1680
Right 1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG 0: 1
1: 0
2: 5
3: 36
4: 301
1096911536_1096911545 19 Left 1096911536 12:54989425-54989447 CCAACCTTTTGGCATCAAGGACT 0: 1
1: 3
2: 16
3: 74
4: 248
Right 1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG 0: 1
1: 0
2: 5
3: 36
4: 301
1096911538_1096911545 15 Left 1096911538 12:54989429-54989451 CCTTTTGGCATCAAGGACTGGTT 0: 1
1: 5
2: 33
3: 59
4: 157
Right 1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG 0: 1
1: 0
2: 5
3: 36
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096911545 Original CRISPR TTTCCATGGGAGCAGGGTGA GGG Intergenic
900661605 1:3787211-3787233 TTTCCGTGGGAACAAGCTGAGGG - Exonic
900684684 1:3940559-3940581 TTTCCATGGTGGCAGGGAGAGGG - Intergenic
901630952 1:10647938-10647960 CTTCCAGGCGAGCAGGGTGGGGG + Exonic
901927011 1:12572754-12572776 TGTCCATGGGAGGAGGAGGAGGG + Exonic
902078520 1:13805548-13805570 ATTCCCTGGGGGCTGGGTGAGGG - Intronic
903226894 1:21898907-21898929 TTTCCCAGGGAGCAGGGAGCTGG + Intronic
903339840 1:22647077-22647099 TCTCCCTAGGAGCAGGGTGCAGG - Intronic
904422886 1:30405442-30405464 TTTCCAGGGGAGAAGTGTGCAGG - Intergenic
905806549 1:40881515-40881537 TGTCACTGGGAGCAGGGAGAGGG - Intergenic
906020031 1:42619799-42619821 CTTTCATGGGAGCAGGTGGATGG - Intronic
906212380 1:44019463-44019485 TTCCCATGGGCGCAGACTGAGGG + Intronic
908346904 1:63242562-63242584 ATTCCATTGGATCAGCGTGAAGG - Intergenic
909016330 1:70383738-70383760 TTCTCAGGGGAGGAGGGTGAGGG + Intronic
910553416 1:88502254-88502276 TTTCCATGGAAGAAGGATTATGG - Intergenic
910590263 1:88922643-88922665 TTTCCATGGATGGAGGGGGATGG - Intergenic
910837815 1:91533346-91533368 TTTCCATGGCAGCTAAGTGAGGG - Intergenic
911175547 1:94813966-94813988 CTTCCCTGGGAGGAGGTTGATGG + Intergenic
913561120 1:120021049-120021071 TTTTCATAGGAGAAGGCTGATGG + Intronic
913637007 1:120772553-120772575 TTTTCATAGGAGAAGGCTGATGG - Intergenic
914281703 1:146180461-146180483 TTTTCATAGGAGAAGGCTGATGG + Intronic
914542748 1:148631397-148631419 TTTTCATAGGAGAAGGCTGATGG + Intronic
914623886 1:149439846-149439868 TTTTCATAGGAGAAGGCTGATGG - Intergenic
915801328 1:158795982-158796004 TTTCCATGATGGCAGGTTGAAGG - Intergenic
916294090 1:163197529-163197551 TTTCCATGGGAGCAGGGCATGGG + Intronic
917120141 1:171638465-171638487 CTTCCCTGGGAGCAGAGGGAGGG - Intronic
918107131 1:181424928-181424950 TGGCCATGGGAGCAGAGTGGAGG - Intronic
920536065 1:206737314-206737336 TATTCAAGGGAGGAGGGTGAGGG + Intergenic
920665780 1:207962176-207962198 TTTAAGTGGGAGGAGGGTGAAGG - Intergenic
920880913 1:209879705-209879727 ATACCATGGGAGCAGAGGGAGGG + Intergenic
921056334 1:211545302-211545324 TTTCCAGAAGAGCAGAGTGAAGG - Intergenic
921623342 1:217350826-217350848 TTTCCATTGCACCAGTGTGAAGG + Intergenic
921718438 1:218443767-218443789 TTGCCATGGGAGGGGGGTGGAGG + Exonic
922817673 1:228462156-228462178 TTTCCATCTGAGATGGGTGAGGG - Intergenic
923648198 1:235845678-235845700 TTTGCGTGGGAGCTGGGTGAGGG + Intronic
924141582 1:241029209-241029231 TTACCATGGGGGGAGGGGGAGGG + Intronic
1065709910 10:28506056-28506078 TTGCCAGGGGTGCAGGGAGAGGG - Intergenic
1067098423 10:43317482-43317504 TTTCCTTGGGAGTAGGCTGCAGG - Intergenic
1068726798 10:60312193-60312215 TCTCCATGGGAGCAGCTTCAGGG + Intronic
1070693730 10:78546439-78546461 TTTCCCAGGGACCAGGGTAAAGG + Intergenic
1071611751 10:87038358-87038380 TTGACATGGCAGCAGGGTGCTGG + Intergenic
1072048041 10:91676535-91676557 TTTCTATTAGAGCAGGATGAAGG - Intergenic
1073193148 10:101666596-101666618 TTTCCATGTGAGTAGGGTGAAGG + Intronic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1074654894 10:115573431-115573453 TTTACATGGGGGCAGGATGGGGG + Intronic
1077028997 11:455192-455214 TCTGCATGTGAGCAGGTTGATGG + Intronic
1077099633 11:816342-816364 TTTCCCTTGGAGCAGGTTGAGGG + Intergenic
1078856650 11:15210786-15210808 TTTGGAGGGGAGCAGGGTAAAGG + Intronic
1079188100 11:18255032-18255054 TTTCAATGGGTGCAGGGGCATGG - Intergenic
1079405747 11:20144187-20144209 TTTCCATGGACGGGGGGTGAAGG + Intergenic
1079782161 11:24621039-24621061 TTAGCATGGGAGCAGGCTCACGG - Intronic
1081060011 11:38462314-38462336 TTTATATGGGGGCAGGATGAGGG + Intergenic
1081686511 11:45046920-45046942 AGTCCTAGGGAGCAGGGTGAGGG + Intergenic
1083121451 11:60516672-60516694 TTTCCCTGGGGGCAGGGGGTAGG + Intronic
1084671900 11:70611944-70611966 TTGCCATGGGAGGTGGGGGAGGG + Intronic
1085190050 11:74612176-74612198 TGTCCATGGGGGTAGGGTGGGGG + Intronic
1086371890 11:86163427-86163449 ATTCTATGGGAGCAGAGTGGAGG + Intergenic
1088226687 11:107628136-107628158 TTTCCAAGAGAGCAAGCTGAGGG + Intronic
1089463304 11:118665827-118665849 TATGCATGGGAGCAGACTGAGGG + Intronic
1090799915 11:130163954-130163976 GTTCCCAGGGAGCAGAGTGAGGG - Intronic
1090920669 11:131203611-131203633 TTGCCATGGGAGGTGGGTCAGGG - Intergenic
1091135676 11:133186833-133186855 TTTCCAGCAGAGGAGGGTGAGGG + Intronic
1091674459 12:2478801-2478823 TTGCCATGGGAGGTGGGAGAAGG - Intronic
1092223436 12:6730906-6730928 TTTGCATGGGAGTAGGGAGTGGG + Intronic
1093130122 12:15381678-15381700 TTTCCATGGGAGCTGCGAAAGGG - Intronic
1093257379 12:16886707-16886729 TGTCCACGGGAGCAGGTAGAAGG - Intergenic
1093426495 12:19034247-19034269 CTTACATGGCAGCAGGGGGAAGG + Intergenic
1093514672 12:19972236-19972258 TTTTCATGGCTGCAGGTTGAGGG - Intergenic
1093517531 12:20007188-20007210 TTTCCAGGGCTGCAGGTTGAAGG - Intergenic
1094541749 12:31368713-31368735 TTTCCAAGAGAAGAGGGTGATGG - Intergenic
1095892751 12:47249961-47249983 TTTGCATGAGAGCTGGGTGAGGG + Intergenic
1095949471 12:47773878-47773900 CTTCCCTGGGTGCTGGGTGAGGG + Intronic
1096077242 12:48813585-48813607 TTTCCATAGGAGAAGGGAGGTGG - Intergenic
1096297563 12:50396737-50396759 CTGCCATGGTAGAAGGGTGAGGG + Intronic
1096686183 12:53289643-53289665 CTTACTTGGGAGCTGGGTGAAGG + Intronic
1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG + Intergenic
1096916324 12:55037317-55037339 TTTCCACCAGAGCAGTGTGATGG - Intergenic
1097186425 12:57198848-57198870 TTCCCAAGGGAGCTGGGTGGTGG - Intronic
1098501714 12:71200177-71200199 TTTTCAGGATAGCAGGGTGAAGG + Intronic
1099418810 12:82426842-82426864 TTTCCATGGGAACAGAGTTCTGG - Intronic
1099894719 12:88630460-88630482 TTTCCATGTGTGCAGGTTGCGGG + Intergenic
1100678647 12:96894714-96894736 TTCCCATGGCAGGAGGGTGATGG - Intergenic
1100932805 12:99630343-99630365 TTTCCATGGGAGAAGGGGACTGG + Intronic
1101345828 12:103885259-103885281 TTTCCATGGTGGGAGGGGGAGGG + Intergenic
1101635293 12:106535569-106535591 TTTGCATGGGAGCTGGGTGAGGG - Intronic
1102205030 12:111084312-111084334 TTTCTAGGGGAGCAGGTGGAGGG + Intronic
1102641569 12:114371538-114371560 TTTTCATGGGAGCAGGTGGCAGG + Intronic
1105885563 13:24638337-24638359 TTTCCAGGGGCGCAGGCAGATGG - Intergenic
1107401168 13:40070718-40070740 TCTCCATGGGAGCAGATTAATGG - Intergenic
1108608185 13:52061117-52061139 TTTCCATGGGGGCAGGGAAGGGG + Intronic
1110366007 13:74686473-74686495 GCTTCATGGGAGAAGGGTGACGG + Intergenic
1111713623 13:91849347-91849369 TTTCCAAGGCAGCCTGGTGAGGG - Intronic
1112224060 13:97520042-97520064 TGTCCATGGGAGCACCTTGAAGG - Intergenic
1112636953 13:101226488-101226510 TTTCCATGGGAACATGGGGATGG - Intronic
1114282553 14:21206633-21206655 ATTTCCTGGGAGCAGGGGGATGG - Intergenic
1114462601 14:22896948-22896970 TTTCCATGGCAACCAGGTGAAGG - Intergenic
1115094821 14:29622068-29622090 TTTCCATGGGAGCATGGAGGGGG + Intronic
1117056431 14:51916712-51916734 TATCCAGGGGTGCAGTGTGATGG + Intronic
1117057035 14:51922870-51922892 TTTCCAAGGCTGCAGGGTGGGGG + Intronic
1117639821 14:57786108-57786130 TTTGCGTGGGAGCTGGGTGAGGG + Intronic
1118014737 14:61648292-61648314 TTTCCAGGGGCTCAGGGAGAGGG + Intronic
1118136349 14:63032415-63032437 TTTGAATGGGAGCACTGTGAAGG - Intronic
1118718118 14:68574727-68574749 TTTCTGTTGGAGAAGGGTGATGG - Intronic
1120191456 14:81443784-81443806 TTTCCATGGTAGCAGGGGTGGGG - Intergenic
1120536514 14:85702717-85702739 TTTCCATTGGAGGAGGGGAAGGG - Intergenic
1122190672 14:100040446-100040468 TTAGCATGGGAGCAGAGAGAAGG + Intronic
1122838861 14:104444824-104444846 TTTCCAAGGCAGCTGGGTGCGGG + Intergenic
1123439897 15:20282588-20282610 TTTACAGGGGATCAGTGTGAAGG - Intergenic
1125833135 15:42730112-42730134 TTTCCAGGTGGGCAGAGTGAGGG - Exonic
1125966153 15:43877072-43877094 TTTCCTTGGGAGCACTGTGATGG - Intronic
1126427899 15:48549359-48549381 TTACCTTGGGAGCAGGGAGGCGG + Intronic
1126578128 15:50217621-50217643 GTTCTGTGGGGGCAGGGTGAGGG - Intronic
1129140805 15:73596385-73596407 TTGCCATGGGTGCAGTGTGGTGG - Intronic
1129240039 15:74245624-74245646 TTCCCATGGCAACCGGGTGATGG - Intronic
1130960058 15:88653268-88653290 GTGCCCTGGGAGCAGGATGAAGG + Intronic
1131990653 15:98089488-98089510 TTCTCATGAGAGCAGGGTGTTGG + Intergenic
1132071282 15:98778566-98778588 TCTCCAGGGGAGCAGGGTTGAGG + Intronic
1132099479 15:99013785-99013807 TTCTCATGAGAGCAGGGTGTTGG - Intergenic
1132906898 16:2287091-2287113 TCTCCTTAGGAGAAGGGTGATGG - Intronic
1133208310 16:4247543-4247565 TTTTCATGAAAGCAGGGTGTTGG + Intergenic
1133646530 16:7769799-7769821 TTTTCAAGGGAGAAGGGAGAAGG + Intergenic
1135138850 16:19904779-19904801 GCTTCAGGGGAGCAGGGTGAAGG + Intergenic
1135641520 16:24123715-24123737 TTTTCATGGGGACAGGGTGCCGG + Intronic
1135828335 16:25750426-25750448 TTTCCATGGGAGAAATGTCATGG + Intronic
1135844359 16:25905275-25905297 CTTCCTTGGCAGCAGGGTGGAGG + Intronic
1136484347 16:30561633-30561655 TTGCCCTGGGAGTAGGGTGCAGG + Intergenic
1136845274 16:33571809-33571831 TTTACAGGGGATCAGTGTGAAGG + Intergenic
1139418410 16:66832528-66832550 GTTCCATGGGAGCTGGGTAAGGG - Intronic
1139884064 16:70196463-70196485 TCTCCGTGGGATCAGGCTGAGGG + Intergenic
1140229256 16:73103995-73104017 TTTGCATGGAAGCTGTGTGATGG + Intergenic
1140368454 16:74399033-74399055 TCTCCGTGGGATCAGGCTGAGGG - Intergenic
1141296627 16:82775794-82775816 TTTGCCTGGGTGCAAGGTGAGGG + Intronic
1141569565 16:84926003-84926025 ATTCGATGGGAGCTGGGTCATGG - Intergenic
1141738137 16:85869114-85869136 TGACTATGGGAGCAGGGTCAGGG + Intergenic
1142114011 16:88347128-88347150 CTTCCCTGGGAGCAGGATGCCGG + Intergenic
1203106982 16_KI270728v1_random:1420462-1420484 TTTACAGGGGATCAGTGTGAAGG + Intergenic
1203155442 16_KI270728v1_random:1872107-1872129 TTTACAGGGGATCAGTGTGAAGG + Intergenic
1143695307 17:8610702-8610724 ATTCCATGGGAGAAGGCGGAAGG - Intronic
1143945007 17:10583376-10583398 TTTCCATGGGAGCTATTTGATGG - Intergenic
1144024075 17:11262235-11262257 TTTTCATGGGGGCAGAGTGTTGG + Intronic
1144884922 17:18451341-18451363 TTTCGGTGGGAGCAGGGAGGAGG - Intergenic
1145147301 17:20493036-20493058 TTTCGGTGGGAGCAGGGAGGAGG + Intergenic
1147599831 17:41738792-41738814 TCTGCAGGGGAGCAGGGTGGAGG + Intergenic
1148352401 17:46950474-46950496 TTTCCCTGGGACAAGTGTGAAGG - Intronic
1148578542 17:48727910-48727932 TTTCCCTGGGAGGAGGAGGAGGG - Intronic
1149656245 17:58310925-58310947 TTCCAAGGGGAGCAGGGTGCTGG + Exonic
1150320809 17:64213044-64213066 TTCCCAGGGGAGCAGTCTGAAGG - Exonic
1151042805 17:70883197-70883219 TTTCCAAGGGTGCAGTGTAATGG + Intergenic
1151049465 17:70960553-70960575 TTTTAATGGGACCAAGGTGACGG - Intergenic
1151504255 17:74516132-74516154 TTACCATGGGAGAAAGGTGGAGG + Intergenic
1151573723 17:74940717-74940739 TTTCCATGGATGGAGGGTGGAGG - Intronic
1151881139 17:76895394-76895416 TTTCCATGGACCCAGGGAGAGGG - Intronic
1152794765 17:82301531-82301553 TCTCCCTGGGAGGAGGGAGAAGG + Intergenic
1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG + Intergenic
1157051490 18:44171413-44171435 TCGCCATGGGAGTAGGATGAAGG - Intergenic
1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG + Exonic
1157841789 18:50966099-50966121 TTTCCTTGGGAGCAGGGGGTGGG - Intergenic
1158520251 18:58166460-58166482 TTGGACTGGGAGCAGGGTGAGGG + Intronic
1159059019 18:63495078-63495100 TATCCATGGGAGCTGAGGGATGG + Intronic
1159741182 18:72173300-72173322 TTTTCAGAGGAGCAGGGGGAGGG - Intergenic
1159817851 18:73099255-73099277 TTTCCATGGGACCTGGGAGGAGG - Intergenic
1159872348 18:73772687-73772709 AATACATGGGAGCAGGGAGAGGG - Intergenic
1160325045 18:77938516-77938538 TTTTAATGGGAGCTGGGTTAAGG - Intergenic
1161761351 19:6175175-6175197 TTTCCCTGGGCTCAGGATGAAGG - Intronic
1163182943 19:15616879-15616901 TGTCCACAGGTGCAGGGTGAGGG + Intronic
1163892251 19:20027409-20027431 TTTTCATGGGAGCAGGGGAGTGG - Intronic
1164180177 19:22811427-22811449 CTTCCCTGTGAGCAGGGTGAAGG - Intergenic
1164227184 19:23256184-23256206 TTTCCCTGTAAGCAGGGTGCTGG + Intergenic
1164294635 19:23899006-23899028 TTTCCATGTAGGCAGGGTGCAGG - Intergenic
1167687078 19:50963149-50963171 TTTCAATGGGAGAAAGGTCAAGG - Intronic
925546025 2:5017677-5017699 ATTCCATGGGACCTGTGTGAAGG + Intergenic
925546702 2:5024486-5024508 TTTCCATGAAAGCAGCCTGATGG - Intergenic
925745605 2:7040957-7040979 TTTCCATGGCAGCAGGATGCAGG + Exonic
928467609 2:31537374-31537396 TTTCCATGGGAGGAGGGGGAAGG - Intronic
929239684 2:39641172-39641194 TTGCCAAGGGCACAGGGTGAGGG - Intergenic
930575535 2:53142497-53142519 TTTCCATGGGTTCAGGATGGGGG - Intergenic
930835196 2:55785483-55785505 TTACAAGGGGAGCAGGTTGAGGG - Intergenic
932267158 2:70377702-70377724 TTTACATGTGAGCAGGGGGCTGG + Intergenic
933990592 2:87631394-87631416 GATCCCTGTGAGCAGGGTGAGGG + Intergenic
935708493 2:105877077-105877099 TTTACATGGGGGCAGGCTTAGGG - Intronic
936092358 2:109509701-109509723 TGTCCTTGTGAGAAGGGTGAGGG - Intergenic
936303254 2:111319430-111319452 GATCCCTGTGAGCAGGGTGAGGG - Intergenic
937818234 2:126276690-126276712 TTGGGATGGGAGCAGGGTGCAGG + Intergenic
939204021 2:139076737-139076759 GTTCCATGGGACCAGGTAGAGGG + Intergenic
941411144 2:165158567-165158589 TTTCCAGGGGTTCATGGTGAGGG - Intronic
943115468 2:183664387-183664409 TTTACATGGCAGCAGGGAGGAGG + Intergenic
944465692 2:199997416-199997438 TTGCCAAGGTAGCAGGGAGAGGG + Intronic
945105878 2:206313772-206313794 TTTCATTGGGGGCAGGGAGAAGG + Exonic
946215980 2:218183946-218183968 TTTCCATGGGCACAGGATGGGGG + Intergenic
948635216 2:239330248-239330270 TTTCCATAGGAGCATCGGGAAGG + Intronic
948723860 2:239920019-239920041 GCACCCTGGGAGCAGGGTGAGGG - Intronic
949020411 2:241738156-241738178 TTACTTCGGGAGCAGGGTGAGGG - Intronic
1170667367 20:18398470-18398492 TGTCCACGGGATCAGGCTGAAGG - Intronic
1171379343 20:24722301-24722323 TTTCCAGATGGGCAGGGTGAGGG + Intergenic
1172022271 20:31923368-31923390 GCTCCAGGAGAGCAGGGTGAGGG - Intronic
1172309875 20:33909390-33909412 TTGCCAGGGGATCAGGGTGAAGG - Intergenic
1173466637 20:43288088-43288110 TTTCCATGGATGCAGGGTTGGGG + Intergenic
1173859802 20:46275880-46275902 CTGCTATGGGAGCAGGATGAGGG + Intronic
1175001966 20:55639148-55639170 TTTCCATTAAAGCAGGGTGAGGG + Intergenic
1175723875 20:61303696-61303718 TTTTCAGGGGAGCAGGGAGGAGG + Intronic
1176277657 20:64281929-64281951 TTTGCATGGGAGGTGGGTGGGGG + Intronic
1176369972 21:6056754-6056776 CTTCCAGGGGAGCATGGTGGGGG - Intergenic
1176515462 21:7780478-7780500 GTCCCATGGGAGCAGGGAGGAGG - Intergenic
1178649490 21:34410490-34410512 GTCCCATGGGAGCAGGGAGGAGG - Intergenic
1179316775 21:40250841-40250863 TTTGAATGGGAAAAGGGTGATGG + Intronic
1179753547 21:43481787-43481809 CTTCCAGGGGAGCATGGTGGGGG + Intergenic
1180056593 21:45362185-45362207 TCCCCTTAGGAGCAGGGTGAGGG + Intergenic
1181848108 22:25729681-25729703 TTTCTGTGGGAGCAGGGATAGGG - Intergenic
1183617523 22:38954580-38954602 TTGCCCGTGGAGCAGGGTGAGGG - Intronic
1184245812 22:43235266-43235288 TGTGCATGGGGGCAGGGCGATGG + Intronic
1184696395 22:46141495-46141517 TTTACAGGGGATCAGTGTGAAGG - Intergenic
949128714 3:476024-476046 TTTCTATTGGAGCAGAGTGGAGG + Intergenic
950157509 3:10734112-10734134 ATTCCATGGGAGAAGGCAGAAGG - Intergenic
954450015 3:50566801-50566823 CTTCCAGGGGAGGAGGGTAAAGG - Intronic
954965879 3:54610487-54610509 ATTCAGTGGGAGCTGGGTGATGG + Intronic
955415095 3:58684638-58684660 TTTCCATGGGGGCATCGGGAAGG + Intergenic
957485406 3:80855333-80855355 TTTCCATGGCTTCAGAGTGAAGG - Intergenic
957947846 3:87087786-87087808 TCTCTATAGGAGCAGGGTAAGGG - Intergenic
958502733 3:94935751-94935773 TTTCCATGGCAGCCAAGTGAAGG - Intergenic
958683138 3:97356397-97356419 TTTCCATGGAATGGGGGTGAGGG - Intronic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
958918028 3:100071503-100071525 TTTACATGGGAGAAGGGTGGGGG + Intronic
959944724 3:112114727-112114749 TTCACATGGGAGGAGGCTGAAGG - Intronic
962880718 3:139573899-139573921 TTTCCATGTGACATGGGTGAAGG + Intronic
963073617 3:141326405-141326427 GTTGCAGGGGAGCAGGGTGGGGG + Intronic
964145339 3:153454647-153454669 TTTCCATGTGAGAAGACTGAGGG + Intergenic
964351404 3:155806595-155806617 GTTCCTTGGGAGCAGGTGGAAGG - Intergenic
965046945 3:163590588-163590610 TTTCCAAGGGCCCAGGGAGAAGG + Intergenic
965181890 3:165414886-165414908 TTAGCATGGGGGCAGGGTGCTGG - Intergenic
966233737 3:177677142-177677164 TTTCCATGGAAGCATGCTCACGG + Intergenic
966489997 3:180516951-180516973 TTAGCATGGGGGCAGGGTGCTGG - Intergenic
966686657 3:182703275-182703297 TTTGCAGGGGAGCTGGGTGAGGG - Intergenic
967282992 3:187840669-187840691 TTTCCCTGGGGGCGGGGTGGGGG - Intergenic
969138525 4:5050461-5050483 TTTTCTTGGGAGAAGGGTGAGGG - Intergenic
969254893 4:5995035-5995057 TTTCCATGGGCAGGGGGTGAGGG - Intergenic
970309437 4:14766797-14766819 TGACCATGGCAGAAGGGTGAAGG + Intergenic
970372054 4:15418015-15418037 TTACCATGGGACCAGAGAGAAGG + Intronic
971511203 4:27426484-27426506 TGTCCATGGGAGGAGGTAGAAGG + Intergenic
972716978 4:41656236-41656258 TTGCAGTGAGAGCAGGGTGAAGG + Intronic
973262462 4:48178684-48178706 TTTCCACCAGAGCAGGGAGAAGG + Intronic
974897242 4:67954156-67954178 TGTCCCTGGGACCAGGATGAAGG - Intronic
975588527 4:75976819-75976841 GGTCCATGGGAGCATGGTGTGGG - Intronic
978089219 4:104692919-104692941 ATTCAAGGGGAGCAAGGTGAAGG - Intergenic
978174760 4:105716682-105716704 TTTCCATGGGAGGTTGGTGGGGG - Intronic
978222483 4:106293530-106293552 TTTCCATGGATGGAGGGTGGAGG - Intronic
980843148 4:138291190-138291212 TTTCAATGGGAGAAGGGGGAGGG - Intergenic
981657876 4:147132477-147132499 TTTCCCTAGGAGAAGGGAGATGG + Intergenic
982717056 4:158819965-158819987 GTTTCATAGGAGCAGGGTTATGG + Intronic
983565569 4:169147466-169147488 TGTGCATGGGGGCAGGGTGGGGG + Intronic
985062493 4:186092924-186092946 TGGCCATGGGAGTAGGGTGCCGG + Intergenic
985681959 5:1260458-1260480 TTTGCAGGTGAGCAGGCTGATGG - Exonic
985949057 5:3209486-3209508 TGTCCAGGGGAGCACGGTGCAGG - Intergenic
988112098 5:26835020-26835042 TTTCCAGGGATGGAGGGTGAGGG - Intergenic
990732575 5:58825531-58825553 TTTCCATTGGAGGAGGATAATGG + Intronic
991084458 5:62635879-62635901 TTTCCATGGTGGCGGGGAGATGG - Intergenic
992532631 5:77666905-77666927 TTTCCTTGGGGGCAGGATCAAGG - Intergenic
993661923 5:90648126-90648148 TTTTCCTTGGAGCAGGGTGCTGG + Intronic
994051325 5:95365776-95365798 GTTCCGTGGGAGCTGGGTGAGGG - Intergenic
994174765 5:96699684-96699706 ATTCCCTTGGAGCAGGGTGAAGG - Intronic
994305520 5:98199264-98199286 TGTGCATGGGGGCAGGGTGGGGG + Intergenic
995738112 5:115325053-115325075 TACCCAGGTGAGCAGGGTGAAGG + Intergenic
996875672 5:128237971-128237993 TTTCATTGGGAGCAGGTTGGAGG + Intergenic
997412097 5:133698174-133698196 TTTCGACGCGAGCAGGGTGTGGG - Intergenic
997444631 5:133932316-133932338 TTTCGAGGGGAGAAGGGGGACGG + Intergenic
997913522 5:137900561-137900583 TTGCCCTGGAAGCAGGGGGAAGG + Intronic
998928026 5:147148799-147148821 TTTCCTTGGCAGCAAGGTGTGGG + Intergenic
999497726 5:152116673-152116695 TTTCCATGGGAGAAGGGAAAAGG + Intergenic
1000065714 5:157691402-157691424 TTGCCAAGGGAGCATGGGGAAGG + Intergenic
1001740729 5:174050912-174050934 TTTCCATGGGAGAAGGACCAAGG - Intronic
1002525966 5:179816459-179816481 TTTCGATGGCAGCAGGTGGAGGG + Intronic
1003340778 6:5218346-5218368 TTTCCTTGGGAGCAGCGCGGAGG + Intronic
1004495208 6:16156433-16156455 TTTCAATGGCAGGAGAGTGAAGG + Intergenic
1006388715 6:33746479-33746501 TTCCCCTGGGAGAAGGGAGAGGG + Intronic
1008360021 6:50606169-50606191 TTTCAATGGGTGGATGGTGAGGG - Intergenic
1010063995 6:71659033-71659055 TTTTCAAGGTAGTAGGGTGATGG - Intergenic
1011729769 6:90249193-90249215 TTGCCATGGGAGCAGAGTGAGGG + Intronic
1012627177 6:101418588-101418610 TTTCCAAGGGAGTATGGTGGGGG + Intronic
1012731605 6:102889190-102889212 TTTTCAGGGGAGCAGGGAGAAGG - Intergenic
1014963119 6:127711791-127711813 TTTCTTAGGGAGCAGGGGGATGG + Intronic
1015147502 6:130004081-130004103 TTTCGCTGGGAGCAGGAAGAGGG - Intergenic
1015593461 6:134844013-134844035 TTTCCATGGGAGTGGGGTGAGGG + Intergenic
1015856639 6:137632121-137632143 TTTCCATGGATGGAGGGTGGCGG + Intergenic
1016462854 6:144296382-144296404 TTTCCAAGGGATGAGGGGGATGG - Intronic
1017630615 6:156392942-156392964 TTGCCCTGGCAGCAGTGTGAAGG - Intergenic
1018103981 6:160465818-160465840 TTTCTATGGACCCAGGGTGAGGG + Intergenic
1018699496 6:166415617-166415639 CTGGCATGGGAGCAGGGAGAAGG - Intronic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1020881761 7:13770261-13770283 TTTCCATGAAAGAAGGCTGATGG - Intergenic
1020987007 7:15148468-15148490 GGTCCATGGGAGGAGGATGAGGG - Intergenic
1021750002 7:23787671-23787693 TTTCCATGGATGCAGGGGGTTGG - Intronic
1021755924 7:23852218-23852240 TTTCCATCATAACAGGGTGATGG - Intergenic
1021795932 7:24254293-24254315 TCTCCATGGGAGAAGGGGGAAGG - Intergenic
1022316291 7:29248327-29248349 TTGGCAAGGGAGCAGGCTGAAGG - Intronic
1022484653 7:30769146-30769168 TTTGCATGGGAGGTGGGGGATGG + Intronic
1024545459 7:50513665-50513687 TTTGTGTGGGAGCTGGGTGAGGG + Intronic
1026673814 7:72412664-72412686 GTTCCATGGGGGAAGGGTGAGGG - Intronic
1029625387 7:101717628-101717650 TTCCCAAGAGAACAGGGTGAGGG - Intergenic
1031743140 7:125459741-125459763 TTCCCATGGGATGAGGGAGAGGG - Intergenic
1032279010 7:130486288-130486310 CCTCCCTGGGAACAGGGTGAAGG + Intronic
1032518695 7:132526274-132526296 TCTCCATGGGGCCATGGTGATGG - Intronic
1034229963 7:149516218-149516240 GCTGCATGGGAGCAGGGTGCAGG - Intergenic
1035272608 7:157729388-157729410 TGTCCACGGGAGCAGAGTGGGGG - Intronic
1035586882 8:783268-783290 TTTCCAAGGGAACAGAGTGCAGG - Intergenic
1036074727 8:5483486-5483508 CTGCCATGGAAGCAGGGAGATGG - Intergenic
1036131342 8:6116688-6116710 TTTCCATGGAAACAGGCTGTGGG + Intergenic
1037615700 8:20517215-20517237 CTGTCATGGGAGCAGGGGGAGGG + Intergenic
1037628257 8:20627688-20627710 TTTCCATGGCAGCAGGGGAAAGG + Intergenic
1038348606 8:26755684-26755706 GTGCCATGGGAGCTTGGTGAAGG - Intronic
1038356705 8:26835930-26835952 TTTGCCTGGGAGAAGGATGAAGG + Intronic
1038421357 8:27436046-27436068 CTTCAGAGGGAGCAGGGTGATGG + Intronic
1039681335 8:39740263-39740285 TTTTCATGGGAGGAAGGGGAAGG - Intergenic
1043271517 8:78339787-78339809 TTTATATGGAAGCAGGGTGCTGG - Intergenic
1043782901 8:84359172-84359194 TTTCTTTGGGAACAGGGTGGGGG + Intronic
1043836238 8:85050189-85050211 TTTTCATGGGAGCACACTGAGGG - Intergenic
1045336287 8:101206260-101206282 TTTCCATGGGAGTGAGGTAAAGG - Intergenic
1045768348 8:105704080-105704102 TTTCCCTGTGGTCAGGGTGAAGG - Intronic
1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG + Intronic
1047113745 8:121818312-121818334 TTTCCATGGGCACAGAGTAAGGG - Intergenic
1047135887 8:122078098-122078120 TTTCCATGACAGGAGGGTCAGGG + Intergenic
1049558016 8:143293170-143293192 TGTCCTTGGGCGCAGGGTGAGGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053009891 9:34627136-34627158 TTTGCATGGGGCCAGGGTTAGGG + Intronic
1055905834 9:81292575-81292597 ATTGCATGGGAGCTGGGTGAGGG - Intergenic
1056384185 9:86081922-86081944 TTTCCTTTGGAGTAGGATGAGGG - Intronic
1057191177 9:93088462-93088484 TTGCCTTGGGAGCAAGGTGAAGG - Intergenic
1058098961 9:100897028-100897050 TTTCAATGGGATCAGGGAAAAGG + Intergenic
1058450144 9:105088910-105088932 TTTCCAAGGGAGCCAGGTGAAGG - Intergenic
1059494452 9:114697952-114697974 TGTCCATGGGAGCATGGGAATGG - Intergenic
1061165010 9:128917215-128917237 TTTCCCTGGGCGCAGGGTGCAGG + Exonic
1061222072 9:129258120-129258142 TTTCCATAGGAGCAGGAAAAAGG + Intergenic
1061959530 9:133980974-133980996 GATCCCTGGGGGCAGGGTGATGG - Intronic
1203651132 Un_KI270751v1:124005-124027 ATTTCAGGGGAGAAGGGTGAAGG - Intergenic
1185525829 X:778084-778106 TATCCGTGGGAGCAGAGTGTGGG - Intergenic
1185617691 X:1433289-1433311 TTGTCATGGGAACAGGGGGAGGG + Intronic
1185684548 X:1917622-1917644 TTTCTAAGGGAGCAGAGTGCAGG + Intergenic
1189229053 X:39437738-39437760 TCTCAATGGGAGGAGGGTCAAGG + Intergenic
1190369987 X:49731181-49731203 TGTGAATGGGAGCTGGGTGAGGG + Intergenic
1190594278 X:52037442-52037464 TTTCCATGGGAGGCAGGGGATGG + Intergenic
1192347320 X:70321773-70321795 TTTCAATGGGAGGAGGATGGAGG - Intronic
1193404235 X:81082503-81082525 GTTGCATGGGAGCTAGGTGAGGG + Intergenic
1194832825 X:98645931-98645953 TTTCCATGGAAGCAGGGGGTTGG - Intergenic
1195586163 X:106567274-106567296 TTAGCATGGGAGCAGGGTGCTGG - Intergenic
1199057879 X:143319216-143319238 TCTGCATGGGAGCTGGGTGAGGG - Intergenic
1200249487 X:154545151-154545173 TTTCCATGGGAGGGGAGGGAGGG - Intronic