ID: 1096913714

View in Genome Browser
Species Human (GRCh38)
Location 12:55009873-55009895
Sequence TGGCCACAGCTGGTACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096913710_1096913714 5 Left 1096913710 12:55009845-55009867 CCTAGAGGATAGTGCAGTGGTTT 0: 1
1: 0
2: 1
3: 29
4: 564
Right 1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG 0: 1
1: 0
2: 5
3: 27
4: 154
1096913704_1096913714 29 Left 1096913704 12:55009821-55009843 CCCCGCAAATTACCACAGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG 0: 1
1: 0
2: 5
3: 27
4: 154
1096913706_1096913714 27 Left 1096913706 12:55009823-55009845 CCGCAAATTACCACAGGAGGTTC 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG 0: 1
1: 0
2: 5
3: 27
4: 154
1096913708_1096913714 17 Left 1096913708 12:55009833-55009855 CCACAGGAGGTTCCTAGAGGATA 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG 0: 1
1: 0
2: 5
3: 27
4: 154
1096913705_1096913714 28 Left 1096913705 12:55009822-55009844 CCCGCAAATTACCACAGGAGGTT 0: 1
1: 0
2: 2
3: 5
4: 98
Right 1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG 0: 1
1: 0
2: 5
3: 27
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096913714 Original CRISPR TGGCCACAGCTGGTACCCAC AGG Intergenic
900140744 1:1138645-1138667 TGGCCACAGTTGGTCCCACCTGG + Intergenic
900520844 1:3104838-3104860 TGGCAGCATCTGGTACCCAGTGG + Intronic
900956935 1:5892015-5892037 TGGCCACAGCAGGAGCTCACGGG + Intronic
901413907 1:9104133-9104155 TGGCCACAGCTGTGGGCCACCGG + Exonic
902673676 1:17993593-17993615 TTGCCAAAGCAGGTACCCACTGG + Intergenic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
902806391 1:18863757-18863779 TGGGCTCAGCTGGTGCCCACTGG - Intronic
905294389 1:36945023-36945045 TGGGCACACCTGCTGCCCACAGG - Intronic
909361730 1:74767747-74767769 TTGCCAATGCTGGTGCCCACAGG - Intergenic
914955571 1:152159071-152159093 TAACCAAAGCTGTTACCCACAGG + Intronic
917615852 1:176743487-176743509 TGGCCAGAGCTGGAAACAACTGG - Intronic
920107334 1:203563248-203563270 TGGACCCTGCTGGTGCCCACTGG - Intergenic
921264725 1:213412685-213412707 TGGCCACTCCTGTCACCCACTGG - Intergenic
922810895 1:228414975-228414997 TGGCCACAGGTGGTCATCACAGG + Exonic
1065047474 10:21757305-21757327 TGGCCACAGCTGTCACACCCTGG + Intronic
1069990280 10:72310960-72310982 TGCCCACTGCTGGGAGCCACTGG + Intergenic
1070170022 10:73925840-73925862 TGGCAAGAGCTGGAACCTACGGG + Intergenic
1072672257 10:97439124-97439146 GGGACACAGCTGCTACCCAGAGG + Intronic
1074702168 10:116102134-116102156 TGGCCACAGATGGCATTCACAGG + Intronic
1075414038 10:122249427-122249449 TGGCCCCAGCTGCCACCAACTGG - Intronic
1075594899 10:123721846-123721868 TGGAGCCAGCTGGTCCCCACAGG - Intronic
1076189779 10:128474977-128474999 TGGCCACAGCAGTTTCTCACTGG + Intergenic
1076538565 10:131198902-131198924 AGGTCACAGCTGGTACCTTCTGG + Intronic
1076879156 10:133231436-133231458 TGGCCGCAGCCGGGACTCACTGG - Exonic
1076924243 10:133474134-133474156 TGGTCACAGCAAGTGCCCACAGG - Intergenic
1076995098 11:293933-293955 TGGCCACACCTGCCTCCCACTGG + Intronic
1077189993 11:1251958-1251980 TGGCCACACTTGGTCCCCACTGG + Intronic
1077190030 11:1252098-1252120 TGGCCACACTCGGTCCCCACTGG + Intronic
1077190042 11:1252138-1252160 TGGCCACACTCGGTCCCCACTGG + Intronic
1077190053 11:1252178-1252200 TGGCCACACTTGGTCCCCACTGG + Intronic
1077356884 11:2122807-2122829 AGGCCAGGGCTGGCACCCACAGG - Intergenic
1077502651 11:2916352-2916374 CTTCCACAGCTGCTACCCACAGG + Intronic
1080532293 11:33188808-33188830 TGGCCACAGATGGTTACCAGTGG - Intergenic
1081767810 11:45624121-45624143 TGACCACAGCTGGTTTCCACTGG - Intergenic
1084764437 11:71298967-71298989 TTGCCACATCTCCTACCCACAGG - Intergenic
1089348064 11:117804286-117804308 TGGCCCCATCTCATACCCACTGG + Intronic
1090080056 11:123606346-123606368 TGCACAGAGCTGGTCCCCACAGG - Intronic
1091965769 12:4740138-4740160 TGGCAACAGCTCTTGCCCACAGG + Intronic
1093920030 12:24849282-24849304 TGGCCACACCTGCTGCCAACTGG - Intronic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1101726949 12:107395710-107395732 TGACCAGAGCTGGCCCCCACTGG - Intronic
1102457112 12:113077735-113077757 TGGCCCGAGCTGGCGCCCACGGG - Exonic
1102638451 12:114345156-114345178 TGGCCAAAGCTGCTGTCCACAGG - Intergenic
1102874056 12:116436050-116436072 TGGACTCAGCTGATCCCCACAGG - Intergenic
1103972825 12:124682638-124682660 TGGCCACAGCTGGGGAGCACAGG - Intergenic
1104237173 12:126950418-126950440 TGCCCACAGCTGGTGTTCACAGG + Intergenic
1106762504 13:32880898-32880920 TGCCCAGAGCTGGTCCCCATGGG - Intergenic
1107444276 13:40456645-40456667 TGAGAACAGCTGGTACCCAGTGG + Intergenic
1112002135 13:95220765-95220787 TGCCCACAGCTATTACCCCCAGG + Intronic
1112700492 13:102002061-102002083 TGCACACAGCTGGCATCCACAGG - Intronic
1113886860 13:113665643-113665665 GGGGCACAGCTGGGACACACTGG - Intergenic
1120293712 14:82610956-82610978 TGGACACATCTGGCACCCTCTGG - Intergenic
1120442554 14:84558796-84558818 TGGCCACAGCTGTTTCACCCTGG + Intergenic
1121282127 14:92706530-92706552 GGGGCACAGCTGCTACCCAGAGG - Exonic
1121797806 14:96750019-96750041 TGGGCAGACCTGTTACCCACGGG - Intergenic
1122985265 14:105208896-105208918 GGGCCACAGCTGGCACCCAGGGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127352823 15:58170011-58170033 CGGGCACAGCTGGATCCCACAGG - Intronic
1127699549 15:61484815-61484837 TGGCCACAGCCCGACCCCACAGG - Intergenic
1129691604 15:77717112-77717134 TGCCCACAGCTGCCACCCAGAGG + Intronic
1130315906 15:82796344-82796366 TGGCCAGAGCTGGTCCCCAGTGG + Intronic
1131538110 15:93254171-93254193 TGGCTACAGCTGGAACAGACCGG + Intergenic
1132295557 15:100731689-100731711 TCGCCACAGCTGCCATCCACTGG + Intergenic
1132541144 16:510399-510421 TAGGCCCAGCTGATACCCACAGG - Intronic
1132671858 16:1105357-1105379 TGGCCACCGCTGGCTCCCAGTGG - Intergenic
1132842739 16:1986202-1986224 TGCCCACAGCAGGTACCCACTGG + Exonic
1132884251 16:2175630-2175652 TGGGCACACCTGGTGGCCACAGG + Intronic
1132934040 16:2472121-2472143 TGGCCGCAGCTGGGCCCCGCTGG + Exonic
1134091117 16:11392213-11392235 TGGGCACAGCTGGACCCCAAGGG + Intronic
1135323434 16:21511839-21511861 TGGCCACAGCTCGTGCCCTCCGG - Intergenic
1136267049 16:29127977-29127999 TGGCCGCAGCTGGGATCCACCGG + Intergenic
1138100257 16:54246602-54246624 TGGCCAGAGCAGGTACACACAGG - Intronic
1138304957 16:55966025-55966047 TGGCCCCAGCTCCTCCCCACAGG + Intergenic
1140995139 16:80251683-80251705 TGTCCTCCGCTGGTACCCATGGG - Intergenic
1141670897 16:85491228-85491250 TGGCCCCAGGTGGCACCCAGAGG - Intergenic
1141893936 16:86946672-86946694 GGGCCCCAGCAGGTACCCTCGGG + Intergenic
1142070336 16:88088300-88088322 TGGCCACAGCTGGGATCCACCGG + Intronic
1143659301 17:8314980-8315002 TGGTCACAGCAGGGACCCTCAGG - Intronic
1145766492 17:27461514-27461536 TGGCCACAGTTGTAACCCTCTGG + Intronic
1145941495 17:28745426-28745448 TGGCCTCATCTGGAACCCAGAGG - Intronic
1148150042 17:45391522-45391544 TGGGCACAGCTGGTATGCATAGG + Intergenic
1148384775 17:47226428-47226450 TGTGCACAGCAGGTACCCAATGG - Intergenic
1148690721 17:49525254-49525276 TGGGCTCAGCTGGATCCCACTGG + Intergenic
1149654954 17:58305240-58305262 TGGCCCCAGCTGTTCCCCAGGGG - Intronic
1150291716 17:63986136-63986158 TGGCCACATCTGCAAACCACAGG + Intergenic
1151469580 17:74309731-74309753 TGGCCAGAGCTGAGCCCCACTGG + Intronic
1155366087 18:25050332-25050354 AGGTCACAGCTGCTCCCCACTGG - Intergenic
1155963960 18:32019002-32019024 TGGCCACAGCGGGTCCGGACAGG - Exonic
1157603825 18:48913193-48913215 TGGCCAAAGCCAGTACCCTCTGG - Intergenic
1159806566 18:72964272-72964294 AGCCCACAGCAGGTACCCAAAGG - Intergenic
1160161513 18:76475682-76475704 TGGCCAGAGCATGGACCCACTGG - Intronic
1162061273 19:8096897-8096919 TGGCGACAGTTTGTACCCTCGGG + Exonic
1163866064 19:19774478-19774500 TAGCCACAGCTGGTGTTCACAGG - Intergenic
1165307943 19:35013623-35013645 TGGCCACGGCGCGAACCCACTGG - Exonic
1166281579 19:41797713-41797735 TGGCTACAGCTGGTACAAAGGGG + Exonic
1166406775 19:42527254-42527276 TGGCTACAGCTGGTACAAAGGGG - Exonic
1166420383 19:42631951-42631973 TGGCCACAACTGGTACAAAGGGG - Intronic
1166772175 19:45290453-45290475 TGGCCACAGCTGGCTGCCACTGG - Intronic
1167147712 19:47693169-47693191 GGTGCACAGCTGGTGCCCACTGG + Intronic
925462098 2:4072467-4072489 TGGCCAGGGCTGGAAGCCACAGG + Intergenic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
929589597 2:43136269-43136291 TGGACTCAGCTGCTACCCACAGG + Intergenic
930550876 2:52833479-52833501 TGGCCAAATTTGGAACCCACTGG - Intergenic
931369712 2:61650830-61650852 TGGGCCCAGCTGGGACCCAGAGG - Intergenic
934886391 2:98029203-98029225 TGGCCATGGCTGGAACCCACTGG - Intergenic
935691084 2:105733129-105733151 TGTCCAAAGCTGGGACCCACTGG - Intergenic
936047415 2:109198165-109198187 TGGCCACAGCAGGGACCTTCTGG + Intronic
938366356 2:130737679-130737701 TGGCCACAGATGGCAGCCACAGG - Intergenic
948518554 2:238521730-238521752 TGGCCACAGCCTGCACCCTCAGG + Intergenic
948695799 2:239732500-239732522 TGGGCACAGCTGTGAACCACCGG + Intergenic
1170687067 20:18579023-18579045 TGGCCACACATTGTACCCACTGG + Intronic
1170791443 20:19512429-19512451 TGGCCCCAGCTGGGACCCCTGGG - Intronic
1171094178 20:22315779-22315801 GGGCCACAGTTAGAACCCACAGG + Intergenic
1171244774 20:23602561-23602583 TGGGAACAGCTGGTGTCCACGGG + Exonic
1171393312 20:24815287-24815309 TGGCCACAGGTGGTCCCCACTGG - Intergenic
1172028274 20:31964395-31964417 TGGCCACAGCTGGTCAGAACTGG - Intergenic
1172813479 20:37668489-37668511 TTGCCACCGCTGGTTCCCATAGG - Intergenic
1172835555 20:37870800-37870822 TGGCCACAGCCTGGAGCCACGGG - Intronic
1173024954 20:39299025-39299047 TGGCTTCAGCTGGGATCCACTGG + Intergenic
1174410432 20:50331525-50331547 TGGCCACACCCGGGACCCACAGG + Intergenic
1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG + Intergenic
1175944736 20:62553441-62553463 TGGCCACAGCAGACACCCAGTGG - Intronic
1181404069 22:22669356-22669378 TTGTCACAGCTGTTCCCCACTGG + Intergenic
1182265563 22:29112277-29112299 TGGCCACAGCTGCCTCACACTGG - Intronic
1182300978 22:29336900-29336922 TGGCAAGGGCTGGCACCCACAGG + Intronic
1182921985 22:34088696-34088718 TGGCCACAGATGCAGCCCACAGG + Intergenic
1184586336 22:45450522-45450544 TGGGCACTGCTGGTGCTCACAGG + Intergenic
1185334235 22:50264448-50264470 TGGTCACTGCTGAGACCCACAGG - Exonic
1185338041 22:50279541-50279563 TGGCCACAGATGGGACCCACAGG - Intronic
949876317 3:8628208-8628230 AGACCACCGCTGGGACCCACAGG + Intronic
953759693 3:45676951-45676973 TGGCCACCGCTGTTATCCGCTGG + Exonic
957608956 3:82442682-82442704 TTGTCTCAGCTGGTATCCACAGG - Intergenic
958904299 3:99924949-99924971 TGGAAACAGTTGATACCCACAGG - Intronic
961185003 3:124907074-124907096 GGACAACAGCTTGTACCCACTGG - Intronic
961204089 3:125067182-125067204 TGAGCACACCTGGTCCCCACAGG - Intergenic
961559127 3:127716836-127716858 GGGACACAGCAGGTACCCTCAGG + Intronic
967133354 3:186492908-186492930 TGCCCACAGCTGCTGCCCTCGGG + Intergenic
969396746 4:6926790-6926812 GGCCCACAGCAGGTACCCAGAGG + Intronic
969677675 4:8623344-8623366 TGGCCACAGCTGAGACCCTGAGG + Intergenic
969678630 4:8628985-8629007 TGGCCACAGCTGAGACCCTGAGG + Intergenic
969679586 4:8634623-8634645 TGGCCACAGCTGAGACCCTGAGG + Intergenic
971887886 4:32476242-32476264 TGGGAGCAGCTGGGACCCACAGG - Intergenic
972221783 4:36964244-36964266 TTCCCACAGCTGGTACATACTGG - Intergenic
974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG + Intergenic
978383884 4:108160818-108160840 TGGCCATAGCTGGTATCCTCTGG + Intronic
978423626 4:108560086-108560108 TGGCCAAAGCTGGTTCCATCTGG - Intergenic
985551808 5:537595-537617 TGGCCGCACCAGGTTCCCACAGG - Intergenic
987861353 5:23492078-23492100 CTGCCATAGCTGGTACCAACAGG - Intergenic
989127976 5:38075289-38075311 TGGCCACAGCTGCTGCCCACTGG - Intergenic
1000536570 5:162485655-162485677 TGAGCACAGCTGGTAGCCGCAGG + Intergenic
1001325513 5:170720984-170721006 GGGACACAGCTGGTTCCCACAGG - Intronic
1007619718 6:43204537-43204559 TGGCCACAGCTGGGACTTACAGG - Exonic
1010999159 6:82568403-82568425 TGCCCTCAGCTGGTGCCCACTGG + Intergenic
1012994557 6:105960425-105960447 AAGCCACAGCTGGTGTCCACTGG + Intergenic
1017019284 6:150127487-150127509 CGGCCACATCTGGTTCTCACTGG + Intergenic
1018903193 6:168061328-168061350 TGGCCTCAGCGTTTACCCACAGG - Intronic
1018903854 6:168064063-168064085 TGGCCCCAGCTGGTCCTCACTGG - Intronic
1019531553 7:1506090-1506112 GGGACCCAGCTGGTGCCCACAGG - Intergenic
1020194490 7:6026512-6026534 AGGCCACAGCTGCTACCCCAAGG + Intronic
1022847469 7:34225374-34225396 TGGTCCCAGCTGCTGCCCACAGG - Intergenic
1024001221 7:45190582-45190604 TGGCCACATGTGGACCCCACCGG + Intergenic
1026909971 7:74085759-74085781 TGGCCGCAGCTTGCACACACGGG - Exonic
1029547194 7:101216743-101216765 TGGCCACAGCTGAAACCGAGGGG - Exonic
1029689818 7:102173876-102173898 TGGCTGCAGCTGGAACCCACTGG - Intronic
1031752247 7:125591098-125591120 AGCCCACAGCTGGAAACCACAGG - Intergenic
1032267860 7:130381210-130381232 TGGCCCCAGCTGATACCCTGGGG - Intronic
1034215728 7:149404409-149404431 TGGCCACAGAAGTTTCCCACTGG - Intergenic
1034540346 7:151754451-151754473 TGGCCACAGCTGGAGCCTTCCGG - Intronic
1039798770 8:40936790-40936812 AAGCCACAACTGGGACCCACGGG + Intergenic
1040035943 8:42870015-42870037 TGTCCACAGTTGGTCTCCACCGG + Exonic
1042373556 8:68020668-68020690 TGGGCACAGCTGGAAGCCACGGG + Intronic
1049222866 8:141435847-141435869 TGGCCAGGGCTGGGACCCACAGG - Intergenic
1055124540 9:72703848-72703870 TGGCACCAGCTGGAACCCATAGG - Intronic
1056442968 9:86638664-86638686 TGGCACCAGCTGGGACACACAGG - Intergenic
1057260359 9:93579696-93579718 TGGCCACAGGTGGGACAGACAGG - Intronic
1058153501 9:101486837-101486859 TGGCCACAGCTGGCACAAGCAGG - Intronic
1059671606 9:116497400-116497422 TGGTCACAGCTCTGACCCACAGG + Intronic
1060429994 9:123542760-123542782 TGACCACAGCTGGTCCCTGCGGG - Intronic
1060863704 9:126977963-126977985 TGGGAGCAGTTGGTACCCACAGG + Intronic
1061088895 9:128415502-128415524 TGGCCACAGCTAGAGGCCACAGG + Intronic
1062146938 9:134994715-134994737 GGGCCACACCTGGTTCCCAAGGG - Intergenic
1187241057 X:17513675-17513697 TGGCCCCAGTTGAGACCCACTGG - Intronic
1189676463 X:43465566-43465588 TAGTAACAGCTGGTACTCACAGG - Intergenic
1189977032 X:46472094-46472116 TTGCCACTGCTGGGGCCCACTGG + Intronic
1192233156 X:69279472-69279494 TGGCCACAGCTGGAAGCAGCTGG + Intergenic
1200087256 X:153613319-153613341 TCACAACAGCTGGTACCCACTGG - Intergenic
1200146586 X:153929514-153929536 TGTCCACATCTGGAGCCCACGGG + Exonic