ID: 1096916035

View in Genome Browser
Species Human (GRCh38)
Location 12:55034558-55034580
Sequence ATTTAGTACTGGAGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096916032_1096916035 -5 Left 1096916032 12:55034540-55034562 CCAGGGGGATTCAGAACTATTTA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1096916035 12:55034558-55034580 ATTTAGTACTGGAGGAGCAAAGG 0: 1
1: 1
2: 1
3: 21
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096916035 Original CRISPR ATTTAGTACTGGAGGAGCAA AGG Intergenic
900159311 1:1216025-1216047 GTCTGGTACTGGAGGAGCAGTGG - Intergenic
900766530 1:4509661-4509683 AGACAGTACTGGGGGAGCAAAGG - Intergenic
904495060 1:30881877-30881899 ATTTAGCCCTGGACAAGCAATGG - Intronic
904621084 1:31775737-31775759 AGTTAGAACTGGAGGAGCAGTGG - Intergenic
905924706 1:41741284-41741306 TGTTAGCACTGGAGGAGCAATGG + Intronic
906184759 1:43853398-43853420 ATTTAGAACTGGACTAACAAGGG - Intronic
906553920 1:46691606-46691628 ACATAGTACTGGAGGAGGTAAGG - Intronic
908582398 1:65529709-65529731 ACTGACTACTGGATGAGCAAAGG - Intronic
911215760 1:95191444-95191466 ATTCAGTGAAGGAGGAGCAAAGG - Intronic
915724940 1:158010754-158010776 ATTTAGGAGAGGAGGAGAAAGGG - Intronic
916666010 1:166968175-166968197 ATTTAGTACTGTAGGAAGAATGG - Intronic
917960486 1:180140494-180140516 ATATAGTAATGCAGGAGGAAGGG + Intergenic
918843848 1:189583158-189583180 ATCTAGTACTAGAGGGGCACTGG + Intergenic
918871733 1:189983768-189983790 CTTCAGTACTGGAGCAGCTAGGG - Intergenic
920422380 1:205843910-205843932 ATTTTATACTGGAGGAAGAATGG + Intronic
920970269 1:210737342-210737364 TTTTTGTACTGGAAGAGAAAGGG - Intronic
1066054826 10:31671052-31671074 ATTAACTACTGAAGGAGCATGGG + Intergenic
1066434584 10:35385380-35385402 ATTTAGTACAGGAGTACCACAGG - Intronic
1067305249 10:45058123-45058145 ATTTAGATCTGGAGGAAGAAGGG - Intergenic
1067691751 10:48506326-48506348 GGTTTGTACTGTAGGAGCAATGG - Intronic
1068747468 10:60549667-60549689 ATTTATTACTTCAGGAGGAATGG + Intronic
1069440393 10:68423412-68423434 ATTTGGAACTGAAGGAGCCACGG + Intronic
1070765210 10:79052534-79052556 AGTTTGCACTGGAGGGGCAAAGG - Intergenic
1074478129 10:113791518-113791540 ATTTAACACTGTAGGAGAAAAGG + Intergenic
1075319460 10:121478532-121478554 CTTTAGTACAGAAGGAACAACGG + Intronic
1075466823 10:122657695-122657717 CCTTAGTACTGGAGGAGGAAGGG + Intergenic
1081204997 11:40264766-40264788 ATTCAGTACTGGAGAAGAATGGG + Intronic
1081524620 11:43917771-43917793 ACTTATTACTGGAAGAGAAAAGG + Intronic
1082198785 11:49337260-49337282 ATAGAGTGCTGGAGGAGCAAGGG + Intergenic
1082641304 11:55664920-55664942 ATTTAGAAAGGGAGGAGAAAAGG + Intergenic
1086657027 11:89370839-89370861 ATAGAGTGCTGGAGGAGCAAGGG - Intronic
1087943645 11:104131488-104131510 TTTTAGTGATGGAGGAGCTATGG - Intronic
1088127610 11:106447830-106447852 ATTTAGGAATGGAAGAGCAGAGG + Intergenic
1090294116 11:125571088-125571110 ATTCAGAACTGGAAGAGCAGGGG - Intronic
1090887725 11:130893883-130893905 ATTTGGTACTGGAGCAGGGAGGG - Intronic
1091074458 11:132602217-132602239 AATTAATATTGGAGGAGAAAGGG + Intronic
1092947490 12:13470412-13470434 ACTGAGTACTGGAGGAGGGATGG + Intergenic
1093564605 12:20588044-20588066 ATTTAGTTATGGAGAAGGAAAGG - Intronic
1093575041 12:20717416-20717438 AATTAGAACTGGATGACCAATGG + Intronic
1096556796 12:52408852-52408874 ATATAGGACAGGAGGAGAAAGGG + Intergenic
1096916035 12:55034558-55034580 ATTTAGTACTGGAGGAGCAAAGG + Intergenic
1100130480 12:91487084-91487106 ATTTTGCACTGAAGGGGCAATGG + Intergenic
1100350471 12:93776660-93776682 ATTCAGTACTGGATGAACAGTGG - Intronic
1102737656 12:115177593-115177615 ATTTGGAACTGATGGAGCAAGGG - Intergenic
1106524301 13:30526710-30526732 ATTTAGTGATGGTGGAGCTAGGG - Intronic
1106908935 13:34441704-34441726 ATTTATTACTATAGGAGCAGAGG - Intergenic
1107919986 13:45196342-45196364 ATTAAGTGCTGCAGGAGTAAAGG - Intronic
1109161313 13:58978279-58978301 ATATAATACTGGAAGAGCATTGG - Intergenic
1109175196 13:59146402-59146424 AGATAATACTGGAGGAGGAAAGG + Intergenic
1109851026 13:68063672-68063694 ATTAAGTAGTGGAGGAGAAAAGG + Intergenic
1110000408 13:70191382-70191404 GTATTGAACTGGAGGAGCAAAGG - Intergenic
1110400916 13:75091029-75091051 ATTAAGTCCTTGAGGAGCAGAGG - Intergenic
1112129266 13:96503549-96503571 ATTTATTACTGGAGGAACACTGG + Intronic
1112782385 13:102915129-102915151 AGTAAGATCTGGAGGAGCAATGG - Intergenic
1113094704 13:106651468-106651490 ATTTATCACTGGAGAAACAATGG - Intergenic
1114486041 14:23062268-23062290 GTTGAGTACTGGTGGAGGAAGGG + Exonic
1114628227 14:24143184-24143206 ATTGACTACTGGATGAGAAAGGG + Intergenic
1114815566 14:25954079-25954101 ATTTAGCTTTGGAGGAGCGAGGG - Intergenic
1116982065 14:51182150-51182172 ATTCAGTGCTGTAGGAGAAAGGG + Intergenic
1119601108 14:75978031-75978053 TTTTAGTAGTGCAGGAGAAAGGG - Intronic
1124715288 15:32054566-32054588 GTTTAGCTCTGGAGGAGCGAAGG - Intronic
1126122409 15:45265401-45265423 GTTTAGTACTGGTGGGACAATGG + Intronic
1127275267 15:57438223-57438245 ATTTATCACTGGAGGTGGAAAGG - Exonic
1130044539 15:80433648-80433670 TTTTGTTACTGGAGGGGCAAAGG + Intronic
1131143626 15:89998242-89998264 AGTTTGCACTGGAGGAGCAGGGG - Intergenic
1131592335 15:93763046-93763068 ATTTAAAAATGTAGGAGCAATGG - Intergenic
1133599113 16:7322053-7322075 ATACAGCACTGGAGGAGAAAAGG - Intronic
1134795642 16:17034102-17034124 ACTAATTAATGGAGGAGCAATGG - Intergenic
1138857410 16:60711052-60711074 TTTTAGCAATGGAGAAGCAAAGG - Intergenic
1142189649 16:88712046-88712068 AGTTCGTTCTGCAGGAGCAAGGG - Intronic
1142561315 17:811172-811194 ATTCAACGCTGGAGGAGCAAAGG + Intronic
1144447422 17:15343987-15344009 CTTTAGTGCTGGAGGAGAAATGG - Intergenic
1144870418 17:18366274-18366296 ATTCAGTGCTGGAGAAGAAATGG - Intergenic
1148477472 17:47938509-47938531 ATGTAATACTGCTGGAGCAAAGG - Intergenic
1149340058 17:55676085-55676107 ATTTAGTATGGGATGAGCCAAGG - Intergenic
1151085143 17:71371846-71371868 ATTTAGTACCAGATGTGCAAAGG - Intergenic
1153990169 18:10390021-10390043 ATTAACTTCTGGAGGAGGAACGG - Intergenic
1155119169 18:22800805-22800827 TTTTGGTCCTAGAGGAGCAAAGG + Intronic
1157001671 18:43534197-43534219 AGATATTAATGGAGGAGCAATGG + Intergenic
1158994455 18:62903512-62903534 ATTTAATACTGGAGAATGAAAGG + Intronic
1161369446 19:3902345-3902367 ATTTAGTTCTGGAGAATCACTGG - Intronic
1162301327 19:9846787-9846809 ATTTAGGTCAGAAGGAGCAAGGG + Intronic
1165447518 19:35864676-35864698 ATCTGGTTCTGGAGGAGGAAGGG + Exonic
1168722261 19:58560631-58560653 CCTTAGTACTAGAGGAACAAAGG - Intergenic
925650905 2:6087986-6088008 AGTTAGGACTGGGGGATCAAGGG + Intergenic
925828148 2:7870577-7870599 ATTAGGTATTGGAGGAACAAAGG - Intergenic
931193447 2:60027652-60027674 TATTATTGCTGGAGGAGCAAGGG + Intergenic
937037499 2:118794081-118794103 AGTGAGAACTAGAGGAGCAAGGG + Intergenic
940355761 2:152739454-152739476 ATTGGGAACTGGAGCAGCAAAGG - Intronic
942756206 2:179344263-179344285 TTCTATTACAGGAGGAGCAAAGG + Intergenic
943234816 2:185304014-185304036 ATTTAGCACTGGGAGAGAAAAGG + Intergenic
946852773 2:223923178-223923200 ATTTAGTCTTGGAAGAGGAAGGG - Intronic
946907308 2:224429452-224429474 ACTTAGTTCTGGAGGGGTAAGGG - Intergenic
948341728 2:237258237-237258259 ATGTAGAACTGGAGTAACAAGGG + Intergenic
949078346 2:242075833-242075855 ATTCAGCACAGGAGGAGCAAAGG + Intergenic
1169299471 20:4429836-4429858 ATTAAGGACAGGAGGAGCCACGG - Intergenic
1170084026 20:12509259-12509281 ATTGAGTGCAGGAGGGGCAATGG + Intergenic
1171500770 20:25591360-25591382 ACTTAGTCCTGCAGGAACAATGG + Intergenic
1173201941 20:40960940-40960962 ATTAAGTACTGGAGGAGCGGGGG + Intergenic
1173409848 20:42800510-42800532 ATTTAGAGCTGCAGAAGCAAGGG - Intronic
1173448349 20:43139814-43139836 ATTTAGAAGTGGAGCAGCATCGG + Intronic
949811180 3:8007926-8007948 CTTTAGTACTGAAGGAACATGGG - Intergenic
952433844 3:33252406-33252428 GTTTAGGGCTGGAGGAGGAATGG - Intergenic
954568844 3:51623673-51623695 ATTTAGAATTAGGGGAGCAAAGG + Intronic
955353809 3:58214015-58214037 ATGTAATACTGGAGGACCCAGGG + Intronic
955519783 3:59763885-59763907 CTTTAGCACTGGAGGCGAAAGGG + Intronic
957142034 3:76372770-76372792 AGTTAGTACTAGAGAAGCAAAGG - Intronic
962566634 3:136667173-136667195 ATTTAAAAATGGAGGAGAAAAGG + Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
969276853 4:6141615-6141637 ATTTGGGAGTGGAGGAGAAAGGG - Intronic
975199393 4:71567852-71567874 GATTATTTCTGGAGGAGCAAGGG + Exonic
975571366 4:75821554-75821576 ATTTAAAAGTGTAGGAGCAAGGG - Intergenic
976422875 4:84866180-84866202 ATTTGGTACATTAGGAGCAAAGG - Intronic
978247807 4:106596157-106596179 ACTTAGTACTGAAGGAGCCCTGG - Intergenic
978393946 4:108258125-108258147 ATTAGATACTGGAGAAGCAATGG + Intergenic
978853212 4:113363164-113363186 AATTAGTACTAGAAGAACAAAGG + Intronic
980423842 4:132599594-132599616 ATTTACTTCTTCAGGAGCAATGG + Intergenic
981435230 4:144712126-144712148 ATTTAGTAATTGAAGAGAAAGGG + Intronic
982114047 4:152082438-152082460 TTTTTGTACTGCAGGAGGAATGG + Intergenic
983274053 4:165596198-165596220 AAATAGTAAGGGAGGAGCAAGGG + Intergenic
986596795 5:9431020-9431042 CTTAAGTACTGTAGGAGCAAAGG + Intronic
986624339 5:9709414-9709436 ACTGAGTACTGGAGTAGCATTGG - Intronic
987048643 5:14130712-14130734 ATTCAGTACTGAAAGAGAAAAGG + Intergenic
987199748 5:15564199-15564221 TTTTAATAATGGAGGAGAAAGGG - Intronic
987906564 5:24085739-24085761 ATTGAGTACTGGAGAAGTGAAGG + Intronic
988256041 5:28821567-28821589 AATCAATACTGGAAGAGCAAAGG - Intergenic
988658324 5:33237061-33237083 TCTTAGGTCTGGAGGAGCAAGGG + Intergenic
989318628 5:40109824-40109846 ATTGAGTGCTGAAGGAGGAAGGG - Intergenic
992985895 5:82229252-82229274 TTACAGTACTGGAGGAGCACTGG + Intronic
998379461 5:141713796-141713818 ATTTAATACAGCATGAGCAAGGG - Intergenic
998410022 5:141902817-141902839 ATTTAACACTGGGGGAGCCAGGG + Intergenic
999014975 5:148092804-148092826 ATTTATTTTTGGAGGAGCAATGG - Intronic
1001025979 5:168224801-168224823 TTTTGTTACTGGAGGAGGAAGGG - Intronic
1003801877 6:9679073-9679095 ATCTAGTTCTGAAGGAGGAAGGG - Intronic
1005018976 6:21399804-21399826 CTCAAGTACTGCAGGAGCAATGG + Intergenic
1009415453 6:63411410-63411432 ATTCAGTAATGGAGGAGATATGG - Intergenic
1010126366 6:72436931-72436953 ATTTAGTACTGTAGGAGTTCAGG - Intergenic
1011851540 6:91635596-91635618 AGTAAGTACTGGAGAAGCCAAGG - Intergenic
1012374090 6:98539976-98539998 TTTTAGTAGTGGAAGAGCACAGG - Intergenic
1012751516 6:103168961-103168983 AATTATTACTAGAGTAGCAAGGG - Intergenic
1013215723 6:108025581-108025603 CCTTAGGACTGAAGGAGCAAGGG - Intergenic
1013630900 6:111984956-111984978 TTTTACTACTTGAGGAGCACAGG - Intergenic
1016770194 6:147840598-147840620 CTGTAGTAGTGGAAGAGCAAAGG + Intergenic
1019131610 6:169881061-169881083 CTTTAGTCCTGGAGGAGCAAAGG + Intergenic
1023101957 7:36726914-36726936 ACTCAGTACTTGATGAGCAAAGG - Intergenic
1023420771 7:39977231-39977253 ATTTAGTACTTGATAAGCAAAGG + Intronic
1026389214 7:69882847-69882869 ATTTGGCATTGGAGGAACAATGG - Intronic
1032570641 7:132992464-132992486 ATGTAGCACTGGGGGAGCAATGG - Intronic
1034763988 7:153700364-153700386 ATTCAGTATCGGAGGAGCAGAGG + Intergenic
1036034078 8:5000179-5000201 ATTTAGCACTGGAGGAGCAATGG - Intergenic
1036941605 8:13057655-13057677 ATGTAGAACTGCAGAAGCAAGGG + Intergenic
1037367418 8:18137772-18137794 ATCTAGCACTGGATGGGCAAGGG - Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1043878949 8:85519482-85519504 ATTTAGTACATGCAGAGCAACGG + Intergenic
1043994699 8:86798736-86798758 ATGTGGTACTGGTGGAGCAGGGG - Intergenic
1046379189 8:113431985-113432007 ATTAAGTACTCCAGGAGCAAAGG - Intronic
1048138432 8:131769470-131769492 TGAAAGTACTGGAGGAGCAAAGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051775797 9:20632377-20632399 ATTTAGAAATGGAGAAGCAAGGG + Intergenic
1055563483 9:77545211-77545233 CTTTAGAAGTGGAGGAGGAAAGG - Intronic
1055602646 9:77935763-77935785 ATTGAATACTGGAGGAACATAGG - Intronic
1057910311 9:99015272-99015294 GTGTGGTCCTGGAGGAGCAAAGG + Intronic
1061620989 9:131811189-131811211 ATTTAGTGCAGGAGAAGCACTGG + Intergenic
1061782977 9:133006767-133006789 AATGAGTACTGGGGAAGCAATGG - Intergenic
1186529624 X:10282154-10282176 CTTTAGGACTGGAGGATCAAAGG - Intergenic
1188311418 X:28621228-28621250 ATTAGGTACTGGGGAAGCAATGG - Intronic
1188469903 X:30526597-30526619 ACTTAGAAATGGAAGAGCAACGG + Intergenic
1191008037 X:55731558-55731580 ATCTGGTACAGGAGGATCAACGG + Exonic
1192452757 X:71253858-71253880 AGGGAGGACTGGAGGAGCAATGG - Intronic
1195550951 X:106170207-106170229 ATATATTACTGGAGGAATAAAGG + Intronic
1197327457 X:125111248-125111270 ATTCAGTACTACAGTAGCAAGGG + Intergenic
1197856058 X:130915160-130915182 ATTTAGGACTGGAAGAACAATGG + Intergenic
1199727351 X:150597572-150597594 ATTTAGAACTTGAAGAGAAAGGG + Intronic