ID: 1096923206

View in Genome Browser
Species Human (GRCh38)
Location 12:55112378-55112400
Sequence GAACCATCTCGGAGTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096923206_1096923209 -7 Left 1096923206 12:55112378-55112400 CCACAAAGACTCCGAGATGGTTC No data
Right 1096923209 12:55112394-55112416 ATGGTTCAAGGTAAGTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096923206 Original CRISPR GAACCATCTCGGAGTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr