ID: 1096924106

View in Genome Browser
Species Human (GRCh38)
Location 12:55123110-55123132
Sequence TCCCTAAGTTCAGGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096924106_1096924110 15 Left 1096924106 12:55123110-55123132 CCATCACTGCCTGAACTTAGGGA No data
Right 1096924110 12:55123148-55123170 ACTCTGCTCTCCACTCTGAATGG 0: 1
1: 0
2: 5
3: 25
4: 224
1096924106_1096924111 19 Left 1096924106 12:55123110-55123132 CCATCACTGCCTGAACTTAGGGA No data
Right 1096924111 12:55123152-55123174 TGCTCTCCACTCTGAATGGCAGG 0: 1
1: 1
2: 2
3: 25
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096924106 Original CRISPR TCCCTAAGTTCAGGCAGTGA TGG (reversed) Intergenic
No off target data available for this crispr