ID: 1096936529

View in Genome Browser
Species Human (GRCh38)
Location 12:55286124-55286146
Sequence ATGGGGTTAGAGGTGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096936529_1096936535 -6 Left 1096936529 12:55286124-55286146 CCATCTCCCACCTCTAACCCCAT No data
Right 1096936535 12:55286141-55286163 CCCCATCTGTCACTGGATTGAGG No data
1096936529_1096936538 4 Left 1096936529 12:55286124-55286146 CCATCTCCCACCTCTAACCCCAT No data
Right 1096936538 12:55286151-55286173 CACTGGATTGAGGTGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096936529 Original CRISPR ATGGGGTTAGAGGTGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr