ID: 1096940306

View in Genome Browser
Species Human (GRCh38)
Location 12:55336807-55336829
Sequence TACCATCCCAAGACTGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1133
Summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 1029}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096940306 Original CRISPR TACCATCCCAAGACTGGATC AGG (reversed) Intergenic
900864745 1:5260313-5260335 TCCCATTCCAAGACTAGTTCTGG - Intergenic
902517176 1:16995851-16995873 TTCCATCCCTAGACAGGACCTGG + Intronic
902685463 1:18074021-18074043 TCCCATGCCAAGGCTGGAGCTGG + Intergenic
904145117 1:28384375-28384397 CACCCTCCCAAGACTGAACCAGG - Intronic
906542194 1:46595761-46595783 CACCATCCAACGACAGGATCTGG + Intronic
906679266 1:47714142-47714164 TACCATACCAGGACTGGGTCAGG + Intergenic
906681004 1:47725395-47725417 CCCCAGCCCAAGGCTGGATCTGG + Intergenic
906958791 1:50401152-50401174 TACTCTCCCAAGACTGAAGCAGG + Intergenic
907994319 1:59613926-59613948 TACCCTCCCAAGACTAAACCAGG + Intronic
908073906 1:60493412-60493434 TACCCTCCCAAGACTAAACCAGG + Intergenic
908451037 1:64255198-64255220 CACCTTCCCAAGACTGAACCGGG + Intronic
909025079 1:70472253-70472275 CACCCTCCCAAGACTGAACCAGG + Intergenic
909047198 1:70724827-70724849 CACCCTCCCAAGACTGAACCAGG - Intergenic
909165169 1:72213654-72213676 TACCCTCCCAAGACTAAACCAGG + Intronic
909343295 1:74555847-74555869 TACCCTCCCAAGACTAAACCAGG + Intergenic
909382511 1:75015431-75015453 CACCCTCCCAAAACTGAATCAGG - Intergenic
909397322 1:75185032-75185054 CACCCTCCCAAGACTGAACCAGG + Intergenic
909485432 1:76167699-76167721 CACCCTCCCAAGACTGAACCAGG - Intronic
909536045 1:76737323-76737345 TACCCTCCCAAGACTAAACCAGG - Intergenic
909536196 1:76739505-76739527 CACCCTCCCAAGACTAAATCAGG + Intergenic
909871398 1:80743764-80743786 TACCATCCCCACCCTGGATGAGG + Intergenic
909882769 1:80900988-80901010 CATCCTCCCAAGACTGAATCAGG + Intergenic
909948388 1:81689910-81689932 TCTCATCCAAAGACTGGGTCTGG - Intronic
910942096 1:92547775-92547797 CACCTTCCCAAGACTAAATCAGG + Intronic
911074421 1:93859147-93859169 CACCATCCCAAGACTAAACCAGG + Intergenic
911148670 1:94576160-94576182 CACCCTCCCAAGACTGAACCAGG - Intergenic
911373905 1:97027165-97027187 CACCCTCCCAAGACTGAACCAGG + Intergenic
911464648 1:98236328-98236350 CACCCTCCCAAGACTGAATCAGG + Intergenic
911632973 1:100203378-100203400 CACCCTCCCAAGACTAAATCAGG + Intronic
912108743 1:106313902-106313924 CACCATCCCAAGACTAAACCAGG - Intergenic
912150821 1:106856641-106856663 TACCTTCCCAAGACTAAACCAGG + Intergenic
913285295 1:117221030-117221052 TACCCTCCCAAGACTAAACCAGG + Intergenic
913337672 1:117724095-117724117 TACCCTCCCAAGACTAAACCAGG + Intergenic
913349925 1:117846199-117846221 CACCCTCCCAAGACTGAACCAGG + Intergenic
913721513 1:121600907-121600929 TACCCTCCCAAGACTAAACCAGG - Intergenic
914218128 1:145652703-145652725 CACCCTCCCAAGACTGAACCAGG - Intronic
914441128 1:147707719-147707741 CACCCTCCCAAGACTAAATCAGG - Intergenic
914470686 1:147975378-147975400 CACCCTCCCAAGACTGAACCAGG - Intronic
915078513 1:153333348-153333370 CAACATCCCAAGACTGAACCAGG + Intronic
915846537 1:159271961-159271983 CACCCTCCCAAGACTAAATCAGG + Intergenic
915990905 1:160515289-160515311 CACCCTCCCAAGACTGAACCAGG + Intronic
916182876 1:162102648-162102670 TATCCTCCCAAGACTGAACCAGG - Intronic
916351155 1:163851138-163851160 CACCATCCCAAGACTAAACCAGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
916594475 1:166230375-166230397 CACCCTCCCAAGACTGAACCAGG - Intergenic
916823978 1:168426874-168426896 AAGCATTCCAGGACTGGATCTGG + Intergenic
916872213 1:168928019-168928041 TACTCTCCCAAGACTGAACCAGG + Intergenic
917009434 1:170454441-170454463 TACCCTCCCAAGACTAAACCAGG - Intergenic
917023011 1:170610921-170610943 TACCCTCCAAAGACTAAATCAGG - Intergenic
917101728 1:171453411-171453433 CACCCTCCCAAGACTGAACCCGG + Intergenic
917269938 1:173261757-173261779 TATCCTCCCAAGACTGAACCAGG + Intergenic
917358039 1:174146677-174146699 TACCCTCCCAAGACTACACCAGG + Intergenic
917505457 1:175623328-175623350 TATTATCCAAAGACTGTATCAGG - Intronic
917682465 1:177381609-177381631 CACCCTCCCAAGACTGAACCAGG - Intergenic
917997196 1:180452842-180452864 CACCCTCCCAAGACTAAATCAGG + Intronic
918786675 1:188772278-188772300 CACCCTCCCAAGACTGAACCTGG + Intergenic
918826211 1:189327980-189328002 CACCATCCCAAGACTAAACCAGG - Intergenic
919332580 1:196190276-196190298 CACCCTCCCAAGACTAAATCAGG - Intergenic
919355775 1:196519721-196519743 CACCCTCCCAAGACTGAACCAGG + Intronic
919489817 1:198193236-198193258 CACCCTCCCAAGACTGAACCAGG + Intronic
919533795 1:198760698-198760720 CACCCTCCCAAGACTGAAGCAGG - Intergenic
919568165 1:199215305-199215327 TACCCTCCCAAGACTGAATCAGG - Intergenic
919594193 1:199541465-199541487 TAACGTCCCAAGATTGAATCAGG + Intergenic
920173857 1:204088115-204088137 AACCATCCTGAGACTGGATCTGG + Intronic
920992859 1:210956626-210956648 TACCCTCCCAAGACTAAACCAGG - Intronic
922248201 1:223821061-223821083 TATCATACCAAAGCTGGATCAGG + Intronic
922390326 1:225134936-225134958 CACCGTCCCAAGACTGAACCAGG - Intronic
923195160 1:231659193-231659215 CACCCTCCCAAGACTGAACCAGG - Intronic
923416452 1:233766881-233766903 TACCCTCCCAAGACTAAAGCAGG - Intergenic
924952762 1:248900008-248900030 CACCCTCCCAAGACTGAACCAGG + Intergenic
1063330710 10:5156150-5156172 TGTCATTCCAAGGCTGGATCAGG - Intergenic
1064370175 10:14745018-14745040 TATCCTCCCAAGACTGAACCAGG - Intronic
1065595077 10:27302651-27302673 TACCCTCCCAAGACTAAACCAGG + Intergenic
1066029975 10:31410717-31410739 TACCCTCCCAAGACTAAACCAGG - Intronic
1066097920 10:32090510-32090532 TAAACTCCCAAGACTGAATCAGG - Intergenic
1066149044 10:32595261-32595283 TACCCTCCCAAGACTAAACCAGG - Intronic
1066264145 10:33758882-33758904 TACCATCCCAACACTGTGCCTGG - Intergenic
1066509474 10:36080305-36080327 TACCCTCCCAAGATTGAATCAGG - Intergenic
1066755513 10:38708269-38708291 CACCATCCCAAGACTAAACCAGG + Intergenic
1068186279 10:53590410-53590432 TACCCTCCCAAGACTGAACAAGG - Intergenic
1068285363 10:54926665-54926687 TACCCTCGCAAGACTGAACCAGG - Intronic
1069123270 10:64596483-64596505 TACCCTCCAAAGGCTGAATCTGG - Intergenic
1069360412 10:67635099-67635121 CACCCTCCCAAGACTGAACCAGG + Intronic
1070870862 10:79751398-79751420 CACCCTCCCAAGACTGAACCAGG + Intergenic
1071035161 10:81236021-81236043 CACCCTCCCAAGACTGAACCAGG - Intergenic
1071071590 10:81700315-81700337 TACCCTCCCAAGACTAAACCAGG + Intergenic
1071193679 10:83132170-83132192 CACCCTCCCAAGACTAAATCAGG - Intergenic
1071317093 10:84412509-84412531 AACCCTCCCAAGACTGAACCAGG - Intronic
1071323464 10:84488453-84488475 TACCCTCCCAAGACTAAACCAGG - Intronic
1071637788 10:87273609-87273631 CACCCTCCCAAGACTGAACCAGG + Intergenic
1071657456 10:87464341-87464363 CACCCTCCCAAGACTGAACCAGG - Intergenic
1072515938 10:96183034-96183056 TACCCTCCCAAGACTAAACCAGG - Intronic
1072835150 10:98703211-98703233 TACCCTCCCAAGACTAAACCAGG + Intronic
1073933971 10:108608100-108608122 TACCCTCCCAAGACTAAACCAGG - Intergenic
1073962672 10:108951952-108951974 CACCATCCCAAGACTAAACCAGG + Intergenic
1074000317 10:109365601-109365623 CACCCTCCCAAGACTGAACCAGG - Intergenic
1074241146 10:111640526-111640548 TACCCTCCCAAGACTAAACCAGG + Intergenic
1074304248 10:112262124-112262146 TTCCATCCCTAAACTGGAACAGG + Intergenic
1074642245 10:115399384-115399406 AACCCTCCCAAGACTGAACCAGG - Intronic
1074795183 10:116935879-116935901 CACCCTCCCAAGACTAAATCAGG - Intronic
1075211455 10:120494615-120494637 GACCAGCCCAGGACTGGACCAGG - Intronic
1077655316 11:4013436-4013458 CACCCTCCCAAGACTAAATCAGG - Intronic
1077696745 11:4400285-4400307 CACCATCCCAAGACTAAACCAGG + Intergenic
1077855373 11:6119003-6119025 CACCGTCCCAAAACTGAATCAGG + Intergenic
1077947855 11:6921727-6921749 TCCCTTCCCCAGACTGCATCTGG - Exonic
1077953082 11:6983186-6983208 CACCCTCCCAAGACTAAATCAGG + Intronic
1077989674 11:7393805-7393827 CAACCTCCCAAGACTGAATCAGG - Intronic
1078035460 11:7800057-7800079 CACTCTCCCAAGACTGAATCAGG + Intergenic
1078743101 11:14086859-14086881 CACCCTCCCAAGACTAAATCAGG - Intronic
1078835075 11:15019712-15019734 CACCTTCCCAAGACTGAACCAGG + Intronic
1079177991 11:18161208-18161230 CACCCTCCCAAGACTGAACCAGG + Intronic
1079276575 11:19043414-19043436 TACCCTCCCAAGAGTGAACCAGG + Intergenic
1079300150 11:19271277-19271299 TACCCTCCCAAGACTAAACCAGG + Intergenic
1079448226 11:20576195-20576217 CACCATCCCAAGACTAAACCAGG + Intergenic
1079738235 11:24024750-24024772 TACCCTCCCAAGGCTGAACCAGG + Intergenic
1079809139 11:24973154-24973176 CACCCTCCCAAGACTGAACCAGG - Intronic
1079868199 11:25761719-25761741 TACCCTCCCAAGACTAAACCAGG + Intergenic
1080221273 11:29907983-29908005 ACCCCTCCCAAGACTGAATCAGG + Intergenic
1080500515 11:32866242-32866264 CACCCTCCCAAGACTGAACCAGG + Intergenic
1080904590 11:36528923-36528945 TACCCTCCCAAGACTGAACCAGG + Intronic
1080906165 11:36547553-36547575 TACCCTCCCAAGACTAAACCAGG + Intronic
1080917746 11:36677154-36677176 TACCCTCCCAAGACTAAACCAGG + Intergenic
1081309028 11:41548190-41548212 CACCCTCCCAAGACTAAATCAGG + Intergenic
1081697442 11:45125052-45125074 CACCATCCCAAGACTAAACCAGG - Intronic
1082126910 11:48443551-48443573 TAACATCCCAAGATTGAAACAGG - Intergenic
1082269290 11:50152268-50152290 CACCATCCCAAGACTAAACCAGG + Intergenic
1082560486 11:54614529-54614551 TAACATCCCAAGATTGAACCAGG - Intergenic
1082618817 11:55395977-55395999 CACCCTCCCAAGACTAAATCAGG - Intergenic
1082684210 11:56218489-56218511 CACCCTCCCAAGACTAAATCAGG - Intergenic
1082723903 11:56712087-56712109 CACCATCCCAAGACTAAACCAGG - Intergenic
1082903307 11:58280038-58280060 TACCCTCCCAAGACTAAACCAGG - Intergenic
1083509883 11:63199331-63199353 AACCCTCCCAAGACTGAACCAGG + Intronic
1083518648 11:63285629-63285651 CACCATCCCAAGACTAAACCAGG + Intronic
1083522753 11:63330798-63330820 TACCCTCCCAAGACTAAACCAGG - Intronic
1085066729 11:73502423-73502445 TACCCTCCCAAGACTAAACCAGG + Intronic
1085307547 11:75496495-75496517 TGTCATCCCAAGAGGGGATCTGG - Intronic
1085368552 11:75976580-75976602 CACCATCCCAAGACTAAACCAGG - Intronic
1086008260 11:82066348-82066370 TAACTTCCCAAGACTGCACCAGG - Intergenic
1086042052 11:82491296-82491318 TAACCTCCCAAGATTGAATCAGG - Intergenic
1086086918 11:82964941-82964963 CACCCTCCCAAGACTGAACCAGG - Intronic
1086117603 11:83269585-83269607 TACCCTCCCAAGACTAAACCAGG + Intronic
1086574425 11:88322697-88322719 CACACTCCCAAGACTGAATCAGG + Intronic
1086779157 11:90880876-90880898 CACCCTCCCAAGACTGAACCAGG + Intergenic
1086792347 11:91058345-91058367 TACCCTCCCAAGACTAAACCAGG + Intergenic
1087373650 11:97317229-97317251 CACCTTCCCAAGACTGAACCAGG - Intergenic
1087482114 11:98715166-98715188 TACCCTCCCAAGACTAAACCAGG - Intergenic
1087740076 11:101877260-101877282 CACCTTCCCAAGACTGAACCAGG - Intergenic
1087881576 11:103422120-103422142 CACCCTCCCAAGACTGAAGCAGG + Intronic
1087898571 11:103614770-103614792 TACCTTCCCAAGACTAAACCAGG + Intergenic
1087911500 11:103759529-103759551 CACCCTCCCAAGACTAAATCAGG + Intergenic
1088471383 11:110190869-110190891 TAACCTCCCAAGATTGAATCAGG + Intronic
1089593926 11:119563530-119563552 CACCCTCCCAAGACTGAACCAGG + Intergenic
1089815913 11:121174904-121174926 CACCCTCCCAAGACTAAATCAGG - Intronic
1090114419 11:123953077-123953099 CACCCTCCCAAGACTGAAACAGG + Intergenic
1090308090 11:125708387-125708409 TACCCTCCCAAGACTAAACCAGG + Intergenic
1090483743 11:127092698-127092720 TACCCTCCCAAGATTGAATCAGG + Intergenic
1091528976 12:1335976-1335998 CACCCTCCCAAGACTGAACCAGG - Intronic
1092320211 12:7464257-7464279 CACCATCCCAAGACTGAACCAGG - Intronic
1092325270 12:7524602-7524624 CACCCTCCCAAGACTGAACCAGG - Intergenic
1092512670 12:9173756-9173778 CACCCTCCCAAGACTGAACCAGG + Intronic
1092519261 12:9250638-9250660 CACCCTCCCAAGACTGAACCAGG + Intergenic
1092639218 12:10485098-10485120 CACCCTCCCAAGACTAAATCAGG + Intergenic
1093085175 12:14859085-14859107 CACCCTCCCAAGACTGAACCAGG - Intronic
1093388366 12:18586498-18586520 CACCATCCCAAGACTGAACCAGG + Intronic
1093402583 12:18764280-18764302 TACCCTCCCAAGACTAAACCAGG + Intergenic
1093664150 12:21792267-21792289 TACCCTCCCAAGACTAAACCAGG - Intergenic
1094127949 12:27043448-27043470 CACCCTCCCAAGACTAAATCAGG + Intronic
1094139727 12:27168541-27168563 TACCCTCCCAAGACTAAACCAGG - Intergenic
1094425539 12:30313441-30313463 TACCCTGCCAAGACTGAACCAGG + Intergenic
1095510029 12:42941179-42941201 CACCCTCCCAAGACTGAACCAGG - Intergenic
1095697945 12:45161838-45161860 TACCCTCCCAAAACTGAACCAGG - Intergenic
1095845900 12:46744316-46744338 CAACCTCCCAAGACTGAATCAGG + Intergenic
1095846137 12:46747031-46747053 CAGCCTCCCAAGACTGAATCAGG + Intergenic
1095914769 12:47466495-47466517 TACCCTCCCAAGACTAAACCAGG - Intergenic
1096035297 12:48463352-48463374 CACCCTCCCAAGACTGAACCAGG + Intergenic
1096042764 12:48533129-48533151 TACCCTCCCAAGACTGAACCAGG + Intergenic
1096940306 12:55336807-55336829 TACCATCCCAAGACTGGATCAGG - Intergenic
1097408729 12:59224725-59224747 CACCCTCCCAAGACTAAATCAGG - Intergenic
1097543923 12:60974762-60974784 CACCCTCCCAAGACTAAATCAGG - Intergenic
1097565356 12:61262676-61262698 TATCCTCCCAAGACTGGACTAGG + Intergenic
1097598242 12:61661033-61661055 CACCCTCCCAAGACTGGACCAGG - Intergenic
1098004396 12:65980646-65980668 TACCCTCCCAAGACTAAACCAGG + Intergenic
1098053545 12:66479347-66479369 TACCCTCCCAAGACTAAACCAGG + Intronic
1098201519 12:68061199-68061221 TACCCTCCCAAGACTAAACCAGG - Intergenic
1098689056 12:73464205-73464227 CACCCTCCCAAGACTAAATCAGG - Intergenic
1098707211 12:73705900-73705922 TACCCTCTCAAGACTAAATCAGG + Intergenic
1098791560 12:74830387-74830409 TACCCTCCCAAGACTGAACCAGG - Intergenic
1098830304 12:75353423-75353445 TGCCCTCCCAAGACTGAACCAGG + Intronic
1099684001 12:85862916-85862938 TACCCTCCCAAGACTAAACCAGG - Intergenic
1100943739 12:99755278-99755300 TACCCTCCCAAGACTGAACCAGG + Intronic
1101174951 12:102140196-102140218 TACCCTCCCAAGACTAAACCAGG - Intronic
1101182855 12:102238681-102238703 CACCATCCGAAGACTAAATCAGG + Intergenic
1101186479 12:102285913-102285935 CACCCTCCCAAGACTGAACCAGG - Intergenic
1101783694 12:107863244-107863266 CACCCTCCCAAGACTAAATCAGG + Intergenic
1101887582 12:108679616-108679638 AATCATCCCAACACTGGAGCAGG + Intronic
1104659583 12:130600880-130600902 TACCATCCCTAGACTTGAAGGGG - Intronic
1105566575 13:21554948-21554970 TACTCTCCCAAGACTAAATCAGG + Intronic
1105659351 13:22476346-22476368 TACCCTCCCAAGACTAGACCAGG - Intergenic
1105776255 13:23663722-23663744 CACCCTCCCAAGACTGAACCAGG - Intronic
1106326033 13:28690801-28690823 TATCATCCCAAGACTAAACCAGG - Intergenic
1107222838 13:38005970-38005992 TAGCCTCCCAAGACTGAACCAGG - Intergenic
1107395303 13:40009448-40009470 CACCTTCCCAAGACTGAACCCGG - Intergenic
1107776946 13:43854404-43854426 CACCCTCCCAAGACTGAACCGGG + Intronic
1107968539 13:45619080-45619102 CACCCTCCCAAGACTAAATCAGG - Intergenic
1108230624 13:48336398-48336420 CACCCTCCCAAGACTAAATCAGG - Intronic
1108854692 13:54778252-54778274 TACCCTCCCAAGACTGAGCCAGG + Intergenic
1109146596 13:58787574-58787596 CACCCTCCCAAGACTGAACCAGG - Intergenic
1109426890 13:62176721-62176743 CACCCTCCCAAGACTGAACCAGG + Intergenic
1109572734 13:64213727-64213749 CACCATCCCAAGACTAAACCAGG - Intergenic
1109615727 13:64831441-64831463 TACCCTCCCAAGACTAAATCAGG + Intergenic
1109816516 13:67591802-67591824 TACCCTCCCAAGACTAAAGCAGG + Intergenic
1110036102 13:70686611-70686633 TACCCTCCCAAGACTAAACCAGG - Intergenic
1110402619 13:75111588-75111610 TACCCTCCCAAGACTAAACCAGG + Intergenic
1110418382 13:75277393-75277415 TACCCTCCCAAGACTAAACCAGG + Intergenic
1111169714 13:84509756-84509778 CACCCTCCCAAGACTGAACCAGG + Intergenic
1111232053 13:85356452-85356474 CACCCTCCCAAGACTGAACCAGG + Intergenic
1111235007 13:85398343-85398365 CACCCTCCCAAGACTGAACCAGG - Intergenic
1111332534 13:86778670-86778692 CACCCTCCCAAGACTGAACCAGG - Intergenic
1114133229 14:19817404-19817426 CACCCTCCCAAGACTGAACCAGG - Intronic
1114603898 14:23980230-23980252 CACCCTCCCAAGACTAAATCAGG + Intronic
1114608382 14:24017159-24017181 TACCTTCCCCAGACTAAATCAGG + Intergenic
1114608908 14:24023008-24023030 CACCCTCCCAAGACTAAATCAGG + Intergenic
1114741078 14:25097947-25097969 CACCCTCCCAAGACTGAACCAGG + Intergenic
1114741875 14:25105645-25105667 CACCCTCCCAAGACTAAATCAGG + Intergenic
1114760130 14:25304915-25304937 CACCCTCCCAAGACTGAAGCAGG + Intergenic
1114771530 14:25432461-25432483 CACCCTCCCAAGACTAGACCAGG + Intergenic
1114900552 14:27052516-27052538 CACCATCCCAAGACTAAATCAGG + Intergenic
1115446438 14:33496126-33496148 CACCCTCCCAAGACTGAATCAGG + Intronic
1116066786 14:39994491-39994513 CACCCTCCCAAGACTGAACCAGG - Intergenic
1116073501 14:40080634-40080656 CACCCTCCCAAGACTGAACCAGG - Intergenic
1116337024 14:43669468-43669490 CACCCTCCCAAGACTGAACCAGG + Intergenic
1116398310 14:44473890-44473912 CACCCTCCCAAGACTGAATCAGG - Intergenic
1116493407 14:45533025-45533047 CACCCTCCCAAGACTGAACCAGG - Intergenic
1116588316 14:46738355-46738377 CACCCTCCCAAGACTGAACCAGG - Intergenic
1116711059 14:48368967-48368989 CACCCTCCCAAGACTAAATCAGG - Intergenic
1116726950 14:48572942-48572964 CACCCTCCCAAGACTGAACCAGG - Intergenic
1116775961 14:49181103-49181125 TACCCTCCCAAGACTAAACCTGG + Intergenic
1116872037 14:50077265-50077287 CACCATCCCAAGACTAAACCAGG + Intergenic
1117260716 14:54030399-54030421 TACCCTCCCAAGACTAAACCAGG - Intergenic
1117641353 14:57802743-57802765 CACCCTCCCAAGACTGAACCAGG + Intronic
1117655771 14:57954703-57954725 TACCCTCCCAAGACTAAACCAGG + Intronic
1117820922 14:59648220-59648242 TACCTTCTCAAGACTGAACCAGG + Intronic
1117824894 14:59691363-59691385 CAACCTCCCAAGACTGCATCAGG + Intronic
1117889795 14:60407153-60407175 CACCTTCCCAAGACTGAATCAGG - Intronic
1118094730 14:62523786-62523808 CACCCTCCCAAGACTAAATCAGG + Intergenic
1118146370 14:63141697-63141719 CACCCTCCCAAGACTAAATCAGG - Intergenic
1118450354 14:65895457-65895479 TACCCTCCCAAGACTAAATCAGG + Intergenic
1118579155 14:67275833-67275855 TACCCTCCCAAGACTAAACCAGG - Intronic
1118926656 14:70196700-70196722 AACCATCCCAAGACTAAACCAGG - Intergenic
1119006816 14:70938842-70938864 CACCCTCCCAAGACTAAATCAGG - Intronic
1119930272 14:78539327-78539349 TACCCTCCCAAGACTAAACCAGG - Intronic
1120408386 14:84117751-84117773 TACCCTCCCAAGACTAAACCAGG - Intergenic
1122181249 14:99956266-99956288 AACCATCCCAAGACTGAGCCAGG - Intergenic
1123127502 14:105958832-105958854 CACCATCCCAAGACTAAACCAGG - Intergenic
1123407974 15:20034644-20034666 CACCATCCCAAGACTAAACCAGG - Intergenic
1123517299 15:21041298-21041320 CACCATCCCAAGACTAAACCAGG - Intergenic
1123576316 15:21673207-21673229 CACCCTCCCAAGACTGAACCAGG - Intergenic
1123612939 15:22115675-22115697 CACCCTCCCAAGACTGAACCAGG - Intergenic
1123840905 15:24246128-24246150 CACCCTCCCAAGACTGAACCAGG + Intergenic
1123853868 15:24386637-24386659 CACCCTCCCAAGACTGAACCAGG + Intergenic
1123869830 15:24559278-24559300 CACCCTCCCAAGACTGAACCAGG + Intergenic
1123884806 15:24715574-24715596 CACCCTCCCAAGACTGAACCAGG - Intergenic
1124450181 15:29781251-29781273 CACCCTCCCAAGACTGAACCAGG + Intronic
1124717469 15:32078570-32078592 CACCCTCCCAAGACTGAACCTGG + Intronic
1124874201 15:33576038-33576060 CACCCTCCCAAGACTGAACCAGG + Intronic
1125220149 15:37323362-37323384 TACCCTCCCAAGACTAAAGCAGG + Intergenic
1125373579 15:39004204-39004226 CACCCTCCCAAGACTGAACCAGG + Intergenic
1125469128 15:39985520-39985542 TACCCTCCCAAGACTAAACCAGG + Intronic
1126248476 15:46538957-46538979 TACCCTCCCAAGACTAAACCAGG - Intergenic
1126476628 15:49071981-49072003 CACCCTCCCAAGACTAAATCAGG + Intergenic
1126784592 15:52167105-52167127 CACCCTCCCAAGACTGAACCAGG + Intronic
1126871406 15:52992276-52992298 CACCTTCCCAAGACTGAACCAGG - Intergenic
1127057441 15:55146592-55146614 CACCATCCCAAGACTAAACCAGG + Intergenic
1127189773 15:56517082-56517104 CACCCTCCCAAGACTGAACCAGG + Intergenic
1127374035 15:58366317-58366339 CACCCTCCCAAGACTCGAGCAGG + Intronic
1129012263 15:72431071-72431093 CACCATCCCAAGACTAAACCAGG - Intergenic
1129560644 15:76563447-76563469 CACCCTCCCAAGACTGAACCAGG + Intronic
1129668358 15:77592366-77592388 TACCATCCCAAACCCAGATCAGG + Intergenic
1130185800 15:81680627-81680649 CACCATCCCAAGACTGAACCAGG + Intergenic
1130703374 15:86208532-86208554 CACCCTCCCAAGACTAAATCAGG - Intronic
1130802329 15:87278031-87278053 CACCCTCCCAAGACTAAATCAGG - Intergenic
1130862738 15:87905577-87905599 TAGCATCCTAAGACTGGATGAGG + Intronic
1131589878 15:93737172-93737194 CACCATCCCAAGACTTAACCGGG - Intergenic
1131988910 15:98073278-98073300 CAACTTCCCAAGATTGGATCAGG - Intergenic
1202985184 15_KI270727v1_random:407452-407474 CACCCTCCCAAGACTGAACCAGG - Intergenic
1135225439 16:20652681-20652703 CACCCTCCCAAGACTAAATCAGG + Intronic
1136643213 16:31585758-31585780 CACCCTCCCAAGACTGAACCAGG - Intergenic
1136653137 16:31690605-31690627 CACCATCCCAAGACTAAACCAGG + Intergenic
1136727172 16:32368573-32368595 CACCATCCCAAGACTAAACCAGG - Intergenic
1138776779 16:59732844-59732866 CAACCTCCCAAGACTGAATCAGG + Intronic
1138883561 16:61047274-61047296 CACACTCCCAAGACTGAATCAGG - Intergenic
1138976197 16:62211169-62211191 TACCTTCCCAAGACTGAACTAGG - Intergenic
1139376255 16:66499379-66499401 CACCATCCCAAGACTAAACCAGG + Intronic
1140018148 16:71208823-71208845 CATCCTCCCAAGACTGAATCAGG + Intronic
1140147714 16:72327813-72327835 TACCCTCCCAAGACTAAACCAGG + Intergenic
1140669783 16:77266458-77266480 CACCCTCCCAAGACTGAACCAGG - Intronic
1202999262 16_KI270728v1_random:149175-149197 CACCATCCCAAGACTAAACCAGG + Intergenic
1203130860 16_KI270728v1_random:1685585-1685607 CACCATCCCAAGACTAAACCAGG + Intergenic
1143337374 17:6182289-6182311 CAACCTCCCAAGACTGAATCAGG + Intergenic
1144121107 17:12153879-12153901 TACCCACCCAAGACTGAAACAGG + Intergenic
1144432243 17:15204283-15204305 CACCCTCCCAAGACTGAACCAGG + Intergenic
1146450145 17:32967029-32967051 TACCCTCCCAAGACTAAACCAGG + Intergenic
1148201081 17:45750408-45750430 TCCAAACCCAAGACTGGAACTGG - Intergenic
1149141786 17:53440069-53440091 CACCATGCCAAGACTAGATCTGG + Intergenic
1149160153 17:53683548-53683570 CAACCTCCCAAGACTGAATCAGG - Intergenic
1149283668 17:55136714-55136736 TACCATCACACTACTGGATCAGG + Intronic
1149395503 17:56237495-56237517 CACCCTCCCAAGACTGAACCAGG - Intronic
1149411439 17:56412193-56412215 CAACATACCAAGACTGAATCAGG - Intronic
1150190117 17:63229660-63229682 CACCCTCCCAAGACTGAACCAGG - Intronic
1153081657 18:1233448-1233470 CACCTTCCCAAGACTGAACCAGG - Intergenic
1153411024 18:4793055-4793077 CACCCTCCCAAGACTGAACCAGG + Intergenic
1153974457 18:10255373-10255395 CACCATCCCAAGACTAAACCAGG - Intergenic
1155111494 18:22719919-22719941 TACCCTCCCAAGACTAAACCAGG + Intergenic
1155120223 18:22811342-22811364 CACCCTCCCAAGACTAAATCAGG - Intronic
1155253732 18:23976094-23976116 CACCGTCCCAAGACTGAACCAGG - Intergenic
1155708887 18:28850975-28850997 TCACCTCCCAAGACTGGAACAGG + Intergenic
1155842400 18:30662166-30662188 CACCCTCCCAAGACTGAACCAGG + Intergenic
1156563191 18:38152889-38152911 CACCCTCCCAAGACTGAACCAGG + Intergenic
1156699759 18:39811690-39811712 CACCCTTCCAAGACTGAATCAGG - Intergenic
1156965114 18:43082107-43082129 CACCCTCCCAAGACTAAATCAGG - Intronic
1157512624 18:48289085-48289107 TCCCATCGCCAGACAGGATCGGG + Intronic
1157773110 18:50367672-50367694 CACCATCCCAAGACTAAACCAGG - Intergenic
1157900579 18:51512488-51512510 CACCCTCCCAAGACTAAATCAGG - Intergenic
1158765333 18:60444034-60444056 CACCCTCCCAAGACTGAACCAGG - Intergenic
1159076970 18:63691484-63691506 CACCCTCCCAAGACTGAACCAGG + Intronic
1159320941 18:66847014-66847036 CACCCTCCCAAGACTGAACCAGG - Intergenic
1159557874 18:69963867-69963889 CACCCTCCCAAGACTAAATCAGG + Intergenic
1159564570 18:70033985-70034007 TATCCTCCCAAGACTGAACCAGG + Intronic
1159693932 18:71529517-71529539 CACCCTCCCAAGACTGAACCAGG + Intergenic
1159905761 18:74090130-74090152 CACCCTCCCAAGACTGAACCAGG - Intronic
1160466435 18:79081332-79081354 TACCCTCCCAAGACTAAACCAGG - Intronic
1164058748 19:21646508-21646530 TACCCTCCCAAGACTGAACCAGG - Intergenic
1164067995 19:21737656-21737678 CACCCTCCCAAGACTGAACCAGG + Intronic
1164093329 19:21980990-21981012 CACCATCCCAAGTCTAAATCAGG + Intronic
1164600056 19:29555836-29555858 TAACCTCCCAAGACTGAACCAGG + Intronic
1165162303 19:33824057-33824079 TACCATCCCTAGGCTGGAAGGGG - Intergenic
1165459740 19:35937281-35937303 TAGCATCCCAAGACTGGACCTGG + Exonic
1166381414 19:42357127-42357149 TCCCAGCCCAGGACTGGCTCAGG - Intronic
1166616328 19:44251176-44251198 CACCATCCCAAGACTAAACCAGG + Intronic
1166908111 19:46129057-46129079 TACACTCCCAAGATTGGACCAGG - Intergenic
925463092 2:4081663-4081685 CACCCTCCCAAGACTGAACCAGG - Intergenic
925647229 2:6048354-6048376 ATCCTTCCCAAGACTGAATCAGG + Intergenic
926987038 2:18635867-18635889 TACCCTCCCAAGATTGAACCAGG - Intergenic
927269500 2:21190448-21190470 TACCCTCCCAAGACTAAACCAGG - Intergenic
927271091 2:21211289-21211311 TACCCTCCCAAGACTAAACCAGG - Intergenic
928354555 2:30598354-30598376 CACCCTCCCAAGACTGAACCAGG - Intronic
928386742 2:30875790-30875812 CACCCTCCCAAGACTGAACCAGG + Intergenic
929280166 2:40069363-40069385 CACCCTCCCAAGACTGAACCAGG - Intergenic
929331166 2:40682974-40682996 TACCCTCCCAAGACTAAACCAGG + Intergenic
929343648 2:40854452-40854474 CACCATCCCAAGACTAAACCAGG + Intergenic
930222994 2:48764269-48764291 CACCCTCCCAAGACTAGACCAGG - Intronic
930229775 2:48831521-48831543 TACATTCCCAAGACTGAACCAGG + Intergenic
930282656 2:49389224-49389246 CACCTTCCCAAGACTGAATCAGG + Intergenic
930290168 2:49483752-49483774 TACCCTCCCAAGACTAAACCAGG + Intergenic
930295187 2:49545130-49545152 CACCCTCCCAAGACTAAATCAGG - Intergenic
930860044 2:56062366-56062388 CACCCTCCCAAGACTAAATCAGG - Intergenic
930951681 2:57150301-57150323 CACCCTCCCAAGACTGAACCAGG + Intergenic
931031324 2:58178018-58178040 CACCCTCCCAAGACTAAATCAGG + Intronic
931130445 2:59329723-59329745 TACCATCCCAAGACTAAACCAGG + Intergenic
931468937 2:62518233-62518255 CACCATCCCAAGACTAAACCAGG - Intergenic
931492850 2:62768444-62768466 TACCCTCCCAAGAGTGAACCAGG + Intronic
931556302 2:63509859-63509881 TACCCTCCCAAGACTAAACCAGG + Intronic
931560786 2:63558710-63558732 CACCCTCCCAAGACTGAACCAGG + Intronic
932181103 2:69646916-69646938 TACCAACCACAGACTGGTTCTGG + Intronic
932649677 2:73541796-73541818 TACCTTCCCAAGACTAAACCAGG + Intronic
933069847 2:77843714-77843736 CACCCTCCCAAGACTGAACCAGG + Intergenic
933115181 2:78460084-78460106 GACCCTCCCAAGACTGAACCAGG + Intergenic
933545723 2:83708819-83708841 CACCCTCCCAAGACTGAACCAGG - Intergenic
933550227 2:83767475-83767497 CACCCTCCCAAGACTGAAGCAGG + Intergenic
933639126 2:84740814-84740836 TCCCATCACAAGACTGGAGTGGG - Intronic
934100178 2:88645501-88645523 CACCCTCCCAAGACTGAACCAGG + Intergenic
934549360 2:95245794-95245816 CACCCTCTCAAGACTGAATCAGG + Intronic
935003576 2:99047001-99047023 CACCCTCCCAAGACTAAATCAGG + Intronic
935489031 2:103694721-103694743 CACCCTCCCAAGACTGAACCAGG - Intergenic
935490993 2:103720034-103720056 CACCATCCCAAGATTGAACCAGG + Intergenic
935604428 2:104956317-104956339 CACCCTCCCAAGACTAAATCAGG - Intergenic
935843729 2:107141982-107142004 TGCCCTCCCAAGACTAAATCAGG - Intergenic
935923296 2:108038837-108038859 CACCCTCCCAAGACTGAACCAGG + Intergenic
936139971 2:109930907-109930929 CACCCTCCCAAGACTAAATCAGG - Intergenic
936172369 2:110187445-110187467 CACCCTCCCAAGACTGAACCAGG + Intronic
936176660 2:110228852-110228874 CACCCTCCCAAGACTAAATCAGG - Intergenic
936204725 2:110440579-110440601 CACCCTCCCAAGACTAAATCAGG + Intronic
936810954 2:116401374-116401396 CACCCTCCCACGACTGAATCAGG + Intergenic
936847654 2:116855964-116855986 CACCATCCCATGACTGAACCAGG + Intergenic
936862594 2:117035341-117035363 CACCCTCCCAAGACTGAACCAGG + Intergenic
937143516 2:119622295-119622317 CACCCTCCCAAGACTAAATCAGG + Intronic
937188603 2:120070259-120070281 TACCCTCCCAAGACTAAACCAGG + Intronic
937507538 2:122554094-122554116 TAACCTCCCAAGACTAAATCAGG + Intergenic
937605904 2:123801265-123801287 CACCCTCCCAAGACTGAACCAGG - Intergenic
937633186 2:124126336-124126358 CACCCTCCCAAGACTAAATCAGG + Intronic
937799306 2:126062708-126062730 CACCCTCCCAAGACTGAAGCCGG - Intergenic
937801625 2:126087496-126087518 GACCCTCCCAAGACTAAATCAGG + Intergenic
938145158 2:128828127-128828149 TACCCTCCCAAGACTAAACCAGG + Intergenic
938217749 2:129535226-129535248 TACCCTCCCAAGACTAAACCAGG + Intergenic
938735316 2:134180613-134180635 TACCATACCAAGGCTGGCTCAGG + Intronic
938848391 2:135235215-135235237 CACCCTCCCAAGACTGAACCAGG + Intronic
939072286 2:137557991-137558013 TACCCTCCCAAGACTAAACCAGG + Intronic
939089353 2:137760574-137760596 CAACCTCCCAAGACTGAATCAGG + Intergenic
939179850 2:138791579-138791601 CACCCTCCCAAGACTGACTCAGG - Intergenic
939199331 2:139014785-139014807 TACCCTCCCAAGAATGAACCAGG - Intergenic
939434727 2:142160628-142160650 CACCCTCCCAAGACTGAAACAGG + Intergenic
939482003 2:142760698-142760720 TACTATTTCGAGACTGGATCTGG - Intergenic
939555182 2:143664845-143664867 CACCATCCCAAGACTAAACCAGG + Intronic
939753351 2:146076698-146076720 CACCATCCCAAGACTAAACCAGG + Intergenic
939912688 2:148003039-148003061 CACCATCCCAAGACTAAACCAGG + Intronic
940087665 2:149879307-149879329 CACCCTCCCAAGACTAAATCAGG - Intergenic
940411059 2:153363663-153363685 CACCATCCCAAGACTAAACCAGG + Intergenic
940433985 2:153629059-153629081 TACCCTCCCAAGACTAAACCAGG - Intergenic
940442145 2:153728916-153728938 CACCCTCCCAAGACTGAACCAGG + Intergenic
940593703 2:155763833-155763855 CACCATCCCAAGACTAAACCAGG - Intergenic
940595142 2:155781986-155782008 TACCCTCCCAAGACTGAATTAGG + Intergenic
940629755 2:156223094-156223116 CACCCTCCCAAGACTGAACCAGG + Intergenic
940705490 2:157099988-157100010 TACCCTCCCAAGACTAAACCAGG - Intergenic
940720464 2:157276537-157276559 TACCCTCCCAAGACTAAACCAGG - Intronic
940758259 2:157707905-157707927 TACCCTCCCAAGACTAAACCAGG + Intergenic
940920870 2:159305292-159305314 CACCCTCCCAAGACTGAATCAGG + Intergenic
940925483 2:159359384-159359406 CACCCTCCCAAGACTAAATCAGG + Intronic
941895522 2:170625279-170625301 TACCCTCCCAAGACTAAACCAGG - Intronic
942729005 2:179043150-179043172 TACCCTCCCAAGACTGAACCAGG + Intronic
942869079 2:180713391-180713413 TACCCTCCCAAGACTGAACCAGG + Intergenic
942876563 2:180806651-180806673 TACCCTCCCAAGACTAAACCAGG - Intergenic
943031394 2:182689958-182689980 CACCCTCCCAAGACTAAATCAGG + Intergenic
943095174 2:183419867-183419889 TACCCTCCCAAGACTAAACCAGG + Intergenic
943140772 2:183978845-183978867 CACCATCCCAAGACTAAACCAGG + Intergenic
943158719 2:184218284-184218306 CACCCTCCCAAGACTGAACCAGG - Intergenic
943200688 2:184819846-184819868 TACCCTCCCAAGAATGAATCAGG + Intronic
943306367 2:186267547-186267569 TACCCTCCCAAGACTAAACCAGG + Intergenic
943628580 2:190225548-190225570 TACCCTCCCAAGACTAAACCAGG + Intronic
943837146 2:192527924-192527946 TACCCTCCCAAGACTAAACCAGG + Intergenic
944126828 2:196303620-196303642 CACCCTCCCAAGACTGAACCAGG - Intronic
944370900 2:198982587-198982609 CACCCTCCCAAGACTGAACCAGG + Intergenic
944392559 2:199231941-199231963 CACCCTCCCAAGACTGAACCAGG - Intergenic
944536922 2:200719780-200719802 CACCCTCCCAAGACTGAACCAGG + Intergenic
944570138 2:201036171-201036193 TACCCTCCCAAGACTAAACCAGG + Intronic
944627578 2:201587924-201587946 TACCCTCCCAAGACTGAACCAGG + Intronic
945023981 2:205602583-205602605 AACCCTCCCAAGACTGAATCAGG - Intronic
945351660 2:208787694-208787716 CACCCTCCCAAGACTAAATCAGG + Intronic
945409499 2:209491723-209491745 CACCCTCCCAAGACTAAATCAGG + Intronic
945820553 2:214659358-214659380 TACCCTCCCAAGACTGAACCAGG - Intergenic
945847422 2:214963343-214963365 TACCCTCCCAAGACTGAGCCAGG + Intronic
946064997 2:216979432-216979454 TACCCTCCCAAGACTAAACCAGG - Intergenic
946092102 2:217236418-217236440 TACCCTCCTAAGACTGAACCAGG - Intergenic
946834667 2:223761181-223761203 TACCTTCTCAAGACAGGAGCTGG + Intronic
946974065 2:225128443-225128465 TACCTTCCCAAGACTAAACCAGG + Intergenic
947068106 2:226253500-226253522 CACCCTCCCAAGACTAAATCAGG + Intergenic
947123670 2:226843988-226844010 CACCCTCCCAAGACTGAACCAGG - Intronic
947132798 2:226946771-226946793 TACCCTCCCAAGACTAAATCAGG + Intronic
948343431 2:237274651-237274673 CACCATCCCAAGACTGAAACAGG + Intergenic
1169776487 20:9260059-9260081 TACCATCCCAGAAGTGGACCAGG + Intronic
1170051185 20:12147329-12147351 CACCCTCCCAAGACTGAAACAGG + Intergenic
1170054722 20:12189052-12189074 TACAATCCTAAGATTGAATCAGG + Intergenic
1170186510 20:13596961-13596983 TACCCTCCCAAGACTAAACCTGG + Intronic
1170413695 20:16117623-16117645 TACCCTCCCAAGACTGAACCAGG - Intergenic
1170752553 20:19164355-19164377 TACCCTCCCAAGACTAAACCAGG - Intergenic
1170766742 20:19296070-19296092 CACCATCCCAAGATTGAACCGGG - Intronic
1170826958 20:19804952-19804974 GACCCTCCCAAGACTGAACCAGG - Intergenic
1171001176 20:21417260-21417282 TACCCTCCCAAGACTAAACCAGG + Intergenic
1171082411 20:22200424-22200446 CACACTCCCAAGACTGAATCAGG + Intergenic
1171110557 20:22477472-22477494 TACCCTCCTAAGACTTAATCAGG + Intergenic
1171443236 20:25183542-25183564 CACCATCCCAAGACTAAACCAGG - Intergenic
1171913405 20:30988741-30988763 CACCCTCCCAAGACTAGACCAGG + Intergenic
1171934947 20:31265748-31265770 CACCATCCCAAGACTAAACCAGG - Intergenic
1171936653 20:31280572-31280594 CACCCTCCCAAGATTGAATCAGG + Intergenic
1173777036 20:45717756-45717778 CACCCTCCCAAGACTGAACCAGG + Intergenic
1176804602 21:13467780-13467802 TAAACTCCCAAGACTGAATCAGG + Intergenic
1177025182 21:15913956-15913978 CACCCTCCCAAGACTAAATCAGG - Intergenic
1177088296 21:16734420-16734442 CACCCTCCCAAGACTAAATCAGG + Intergenic
1177111768 21:17037524-17037546 TACCCTCCCAAGACTAAAACAGG + Intergenic
1177117906 21:17107900-17107922 CACCCTCCCAAGACTGAACCAGG + Intergenic
1177556369 21:22694187-22694209 TACCCTCCCAAGACTGAACCAGG - Intergenic
1178033823 21:28558394-28558416 CACCCTCCCAAGACTAGACCAGG + Intergenic
1179243137 21:39609393-39609415 CACCATCACCAGCCTGGATCAGG + Intronic
1180306986 22:11136168-11136190 CACCATCCCAAGACTAAACCAGG + Intergenic
1180545506 22:16498351-16498373 CACCATCCCAAGACTAAACCAGG + Intergenic
1181360865 22:22334184-22334206 CACCCTCCCAAGACTAAATCAGG + Intergenic
1181537474 22:23554013-23554035 TTCCCTTCCAAGACAGGATCTGG + Intergenic
1182622814 22:31627186-31627208 GACCAGCCCCAGCCTGGATCGGG - Intronic
949150576 3:761867-761889 CACCATCCCAAGACTAAATCAGG + Intergenic
950287694 3:11758012-11758034 TGCCCTCCCAAGACTGAATGGGG - Intergenic
950323393 3:12080015-12080037 CACCATCCCAAGACTGAACCAGG - Intronic
950599802 3:14023358-14023380 CACCCTCCCAAGACTGAATCAGG - Intronic
950757973 3:15193026-15193048 CACCCTCCCAAGACTAAATCAGG + Intergenic
950922793 3:16712263-16712285 TACCCTTCCAAGACTGAACCAGG - Intergenic
951191558 3:19778165-19778187 CACCCTCCCAAGACTAAATCAGG + Intergenic
951324153 3:21282449-21282471 CACCATCCCAAGACTAAACCAGG - Intergenic
951368591 3:21815608-21815630 CACCATCCCAAGACTAAACCAGG + Intronic
951490662 3:23267483-23267505 CACCATCCCAAGACTAAACCAGG + Intronic
951649342 3:24932271-24932293 CACCATCCTAAAACTGGACCAGG + Intergenic
951672644 3:25202147-25202169 CACCCTCCCAAGACTAAATCAGG - Intronic
951747507 3:25995838-25995860 CACCCTCCCAAGACTAAATCAGG - Intergenic
951836836 3:26992904-26992926 TACCCTCCCAAGACTAAACCAGG + Intergenic
951964442 3:28366856-28366878 CACCCTCCCAAGACTAAATCAGG - Intronic
952074002 3:29673682-29673704 TACCCTCCCAAGACTAAACCAGG + Intronic
952195404 3:31070100-31070122 TAACCTCCCAAGACTGAACCAGG - Intergenic
952590739 3:34950978-34951000 CACCCTCCCAAGACTGGATCAGG + Intergenic
952593349 3:34985116-34985138 TAGCATCTAAAGAATGGATCAGG - Intergenic
952616642 3:35281350-35281372 TACCCTCACAAGACTGAAACAGG + Intergenic
952673340 3:35997366-35997388 CACCCTCCCAAGACTGAACCAGG - Intergenic
953079769 3:39605364-39605386 CACCCTCCCAAGACTGAACCAGG - Intergenic
954491246 3:50907933-50907955 TGCCCTCCCAAGACTGAACCAGG - Intronic
954502032 3:51026696-51026718 CAGCATCCCAAGACTGAACCAGG - Intronic
954769712 3:52955632-52955654 CACCCTCCCAAGACTGAACCAGG + Intronic
955642382 3:61099627-61099649 CACCCACCCAAGACTGAATCAGG - Intronic
955895723 3:63697669-63697691 CACCATCCCAAGACTAAAGCAGG + Intergenic
956038724 3:65123479-65123501 TACCATCCCAAGACTAAACCAGG + Intergenic
956255549 3:67279683-67279705 CACCCTCCCAAGACTAAATCAGG + Intergenic
956269075 3:67430880-67430902 CACCCTCCCAAGACTAAATCAGG + Intronic
956298556 3:67742362-67742384 TAACCTACCAAGACTGAATCAGG - Intergenic
956356027 3:68393284-68393306 CACCCTCCCAAGACTAAATCAGG + Intronic
956375038 3:68605217-68605239 CACCCTCCCAAGACTGAATCGGG + Intergenic
957700382 3:83702649-83702671 CACCATCCCAAGACTATACCAGG + Intergenic
957915179 3:86679392-86679414 CAATATCCCAAGATTGGATCAGG - Intergenic
958105765 3:89070617-89070639 CACCCTCCCAAGACTAAATCAGG + Intergenic
958155924 3:89755849-89755871 TACCCTCCCAAGACTGAACCAGG + Intergenic
958423318 3:93953007-93953029 CACCCTCCCAAGACTACATCAGG + Intronic
958480022 3:94634061-94634083 CACCCTCCCAAGACTAAATCAGG + Intergenic
958515547 3:95110521-95110543 CACCCTCCCAAGACTGAACCAGG - Intergenic
958523619 3:95223896-95223918 CACCCTCCCAAGACTGAACCAGG - Intergenic
958553838 3:95648479-95648501 TACCCTCCCAAGACTAAACCAGG + Intergenic
958578757 3:95989103-95989125 TACCCTCCCAAGACTAAACCAGG + Intergenic
958624721 3:96609563-96609585 TATAATCACCAGACTGGATCTGG - Intergenic
958703121 3:97618690-97618712 CACCCTCCCAAGACTGAACCAGG + Intronic
959030738 3:101296793-101296815 CACCCTCCCAAGACTAAATCAGG - Intronic
959043960 3:101451144-101451166 CACCCTCCCAAGACTAAATCAGG + Intronic
959052535 3:101537923-101537945 CACCCTCCCAAGACTAAATCAGG - Intergenic
959101208 3:102011610-102011632 CACCCTCCCAAGACTAAATCAGG + Intergenic
959170052 3:102833453-102833475 CACCATACCAAGACTGAAGCAGG + Intergenic
959264063 3:104115614-104115636 CACCATCACAAGACTGAACCAGG + Intergenic
959295961 3:104534398-104534420 CACCATCCCAAGACTGAACCAGG + Intergenic
959301501 3:104608040-104608062 CACCCTCCCAAGACTGCACCAGG + Intergenic
959433598 3:106285336-106285358 CACCCTCCCAAGACTGAACCAGG + Intergenic
959801303 3:110498459-110498481 CACCCTCCCAAGACTAAATCAGG + Intergenic
959816106 3:110675005-110675027 CACCATCCGAAGACTAAATCAGG + Intergenic
959828691 3:110833564-110833586 CACCCTCCCAAGACTAAATCAGG - Intergenic
959829499 3:110843368-110843390 CACCCTCCCAAGACTAAATCAGG - Intergenic
959848387 3:111060098-111060120 CACCCTCCCAAGACTAAATCAGG + Intergenic
959939859 3:112069538-112069560 TACCCTCCCAAGACTAAACCAGG - Intronic
960276922 3:115739084-115739106 CACCCTCCCAAGACTGAACCAGG - Intergenic
960734287 3:120761132-120761154 TACCCTCCCAAGACTAAACCAGG - Intronic
960762916 3:121093485-121093507 TACCCTCCCAAGACTAAACCAGG - Intronic
960768957 3:121170620-121170642 TACCCTCCCAAGACTAAACCAGG + Intronic
960782373 3:121333802-121333824 CACCCTCCCAAGACTGAACCAGG + Intronic
960841850 3:121967115-121967137 CACCCTCCCAAGACTGAACCAGG + Intergenic
962064688 3:131966650-131966672 CACCATCCCAAGACTAAACCAGG + Intronic
962175261 3:133146677-133146699 CACCATCCCAAGACTAAACCAGG - Intronic
962335333 3:134525094-134525116 CACCATCCGAAGACTGAACCAGG - Intronic
962672144 3:137719515-137719537 CACCCTCCCAAGACTGAACCAGG + Intergenic
963415981 3:144996074-144996096 CACCCTCCCAAGACTGAACCAGG - Intergenic
963532347 3:146486598-146486620 CACCATCCCAAGACTAAACCAGG + Intronic
963568614 3:146963198-146963220 TACCCTCCCAAGACTAAACCAGG - Intergenic
963616097 3:147539919-147539941 CACCTTCCCAAGACTGAGTCGGG - Intergenic
963913635 3:150837461-150837483 CACCATCCCAAGACTGAACCAGG - Intergenic
963925690 3:150948637-150948659 CACCTTCCCAAGACTGGACCAGG + Intronic
963993626 3:151681689-151681711 CACCCTCCCAAGACTGAACCAGG + Intergenic
964202645 3:154135289-154135311 TACCCTCCCAAGACTGAACTAGG - Intronic
964294851 3:155222374-155222396 TACCCGCCCAAGACTGAACCAGG - Intergenic
964564753 3:158037557-158037579 CACCATCCCAAGACTAAACCAGG + Intergenic
964671584 3:159231843-159231865 CACCCTCCCAAGACTAAATCAGG - Intronic
965009388 3:163066405-163066427 CACCTTCCCAAGACTGAACCAGG + Intergenic
965203403 3:165690740-165690762 TACCTTATCAAGAATGGATCTGG + Intergenic
965256556 3:166421169-166421191 CACCCTCCCAAGACTGAAACAGG - Intergenic
965293553 3:166914914-166914936 TACCTTCCCAAAACTGAACCAGG - Intergenic
966133877 3:176676250-176676272 CACCATCCCAAGACTAAACCAGG + Intergenic
966152642 3:176881213-176881235 CACCCTCCCAAGACTGAATCAGG + Intergenic
966320190 3:178693976-178693998 CACCCTCCCAAGACTGAAACAGG - Intronic
966341557 3:178930589-178930611 CACCCTCCCAAGACTGGGCCAGG + Intergenic
966488603 3:180500463-180500485 CACCCTCCCAAGACTGAACCAGG - Intergenic
966652044 3:182312303-182312325 CACCCTCCCAAGACTGAACCAGG - Intergenic
966652681 3:182318644-182318666 CACCCTCCCAAGACTGAACCAGG - Intergenic
966991854 3:185240481-185240503 CAACCTCCCAAGACTGAATCAGG - Intronic
967637714 3:191823594-191823616 TACCCTCCCAAGTCTGAAGCAGG + Intergenic
968217867 3:196909190-196909212 CACCTTCCCAAGACTAAATCAGG + Intronic
968436830 4:596471-596493 TACCCTCCCAAGACTGAACCAGG - Intergenic
968696212 4:2029530-2029552 TACCCTCCCAAGACTGAACCAGG - Intronic
970259545 4:14209811-14209833 CACCCTCCCAAGACTGAACCAGG - Intergenic
970412405 4:15821606-15821628 CACCCTCCCAAGACTGAACCAGG + Intronic
970975398 4:22037561-22037583 CACCCTCCCAAGACTGAATCAGG - Intergenic
970983274 4:22126575-22126597 TACCCTCCCAAGACTAAATAAGG + Intergenic
971006421 4:22378848-22378870 AACCCTCCCAAGACTGAACCAGG - Intronic
971270105 4:25135491-25135513 CACCCTCCCAAGACTGAACCAGG + Intronic
971952448 4:33371539-33371561 CAGCAACCCAAGACTGAATCAGG + Intergenic
972100989 4:35416824-35416846 CACCCTCCCAAGACTAAATCAGG + Intergenic
972135993 4:35894941-35894963 GACCCTCCCAAGACTGAACCAGG + Intergenic
972146639 4:36035293-36035315 CACCCTCCCAAGACTGAAGCAGG - Intronic
972208357 4:36805209-36805231 CACCATCCCAAGACTAAACCAGG - Intergenic
972335627 4:38105121-38105143 TCCCACCTCAAGACTGGATGAGG + Intronic
972819677 4:42685417-42685439 CACCCTCCCAAGACTGAACCAGG - Intergenic
972828956 4:42791943-42791965 CACCCTCCCAAGACTAAATCAGG - Intergenic
972858696 4:43139938-43139960 CACCCTCCCAAGACTGAACCAGG - Intergenic
973273319 4:48283326-48283348 CACCCTCCCAAGACTAAATCAGG + Intergenic
973284486 4:48400216-48400238 CACCCTCCCAAGACTGAACCAGG - Intronic
973530040 4:51827618-51827640 GACCCTCCCAAGACTGAACCAGG - Intergenic
973575111 4:52279621-52279643 CACCCTCCCAAGACTGAACCAGG + Intergenic
973883846 4:55300562-55300584 CACCCTCCCAAGACTAAATCAGG + Intergenic
974158124 4:58101241-58101263 TACCCTCCCACAACTGGACCAGG - Intergenic
974230933 4:59112475-59112497 TATCCTCCCAAGACTGAACCAGG - Intergenic
974504098 4:62746001-62746023 CACCATCCCAAGACTAAATCAGG + Intergenic
974539519 4:63216240-63216262 TACCTTCTCAAGACTGAACCAGG - Intergenic
974663275 4:64922809-64922831 CACCCTCCCAAGACTGAACCAGG + Intergenic
974814334 4:66985895-66985917 CACCCTCCCAAGACTGAACCGGG - Intergenic
974899395 4:67978719-67978741 CACCCTCCTAAGACTGAATCAGG - Intergenic
975030228 4:69605851-69605873 CACCCTCCCAAGACTAAATCAGG + Intronic
975158592 4:71099881-71099903 TATCCTCCCAAGACTGAACCAGG + Intergenic
975194528 4:71508537-71508559 CACCTTCCCAAGACTGAACCAGG + Intronic
975348698 4:73322594-73322616 CACCATCCCAAGACTAAATCAGG + Intergenic
975998595 4:80344426-80344448 CACCCTCCCAAGACTGAACCAGG + Intronic
976438595 4:85046975-85046997 TACCCTCCCAAGACTAAACCAGG + Intergenic
976655616 4:87485778-87485800 TACCCTCCCAAGACTAAATCAGG - Intronic
976793084 4:88902035-88902057 CACCCTCCCAAGACTGAAACAGG + Intronic
976795044 4:88922978-88923000 CACCATCCCAAGACTAAACCAGG + Intronic
976810338 4:89093439-89093461 CACCATCCCAAGACTAAACCAGG - Intronic
977002734 4:91523587-91523609 TACCCTCCCAAGACTAAACCAGG - Intronic
977029203 4:91861039-91861061 CACCCTCCCAAGACTAAATCAGG - Intergenic
977154796 4:93558513-93558535 CACCCTCCCAAGACTAAATCAGG + Intronic
977199847 4:94102328-94102350 CACCCTCCCAAGACTAAATCAGG + Intergenic
977479990 4:97563155-97563177 CACCCTCCCAAGACTAAATCAGG - Intronic
977502407 4:97857372-97857394 CACCCTCCCAAGACTGAAACAGG - Intronic
977524031 4:98122908-98122930 CACCCTCCCAAGACTGAACCAGG - Intronic
977604328 4:98967263-98967285 TACTATCACAAATCTGGATCAGG - Intergenic
977824126 4:101509627-101509649 TACCCTCCCAAGACTAAACCAGG - Intronic
977863679 4:101997634-101997656 CACCATCCCAAGACTAAACCAGG - Intronic
977968813 4:103189071-103189093 CACCCTCCCAAGACTAAATCAGG + Intronic
978045663 4:104123878-104123900 AACCCTCCCAAGACTGAACCAGG + Intergenic
978115700 4:105018003-105018025 CACCCTCCCAAGACTGAACCAGG + Intergenic
978186607 4:105863526-105863548 CACCCTCCCAAGACTAAATCAGG + Intronic
978196841 4:105981773-105981795 TACCCTCCCAAGACTAAACCAGG - Intronic
978231442 4:106405163-106405185 TACCCTCCCAAGACTAAACCAGG - Intergenic
978257790 4:106713091-106713113 CACCCTCCCAAGACTGAACCAGG - Intergenic
978658680 4:111097354-111097376 TACCCTCCCAAGACTAAACCAGG - Intergenic
979006935 4:115311030-115311052 TACCCTCCCAAGACTGAACCGGG - Intergenic
979006943 4:115311071-115311093 TACCCTCCCAAGACTGAACTGGG - Intergenic
979052242 4:115950252-115950274 TAATATCTCAAGACTGAATCAGG - Intergenic
979103780 4:116658645-116658667 TACCATCCAAAGACTAAACCAGG + Intergenic
979165189 4:117519814-117519836 CACCCTCCCAAGACTAAATCAGG - Intergenic
979220485 4:118217973-118217995 TACCCTCCCAAGACTAAACCAGG + Intronic
979301343 4:119091092-119091114 CACCCTCCCAAGACTGAACCAGG - Intergenic
979373572 4:119917914-119917936 CACCCTCCCAAGACTCAATCAGG + Intergenic
979506002 4:121497831-121497853 TACCCTCCCAAGACTAAACCAGG + Intergenic
979512539 4:121570723-121570745 TACCCTCCCAAGACTAAATCAGG + Intergenic
979529347 4:121752469-121752491 TACCCTCCCAAGACTAAACCAGG + Intergenic
979742696 4:124170920-124170942 CACCCTCCCAAGACTGAATCAGG + Intergenic
979819126 4:125149110-125149132 CACCATCCCAAGACTAAATCAGG - Intergenic
980021819 4:127719695-127719717 CACCCTCCCAAGACTGAACCAGG - Exonic
980331547 4:131416797-131416819 CACCCTCCCAAGACTGAACCAGG + Intergenic
980664229 4:135907664-135907686 CACCCTCCCAAGACTGAACCAGG - Intergenic
981126609 4:141114431-141114453 CACCCTCCCAAGACTAAATCAGG + Intronic
981151201 4:141381189-141381211 TACCCTCCCAAGACTAAACCAGG + Intergenic
981198297 4:141945941-141945963 CACCCTCCAAAGACTGAATCAGG - Intergenic
981208235 4:142069762-142069784 CACCATCCCAAGACTAAACCAGG + Intronic
981458657 4:144986460-144986482 CACCCTCCCAAGACTAAATCAGG - Intronic
981630023 4:146807667-146807689 TACCCTCCCAAGACTATACCAGG + Intronic
981664985 4:147214063-147214085 CACCCTCCCAAGACTGAACCAGG - Intergenic
981850311 4:149221821-149221843 CACCCTCCCAAGACTGAATCAGG + Intergenic
982294973 4:153818658-153818680 CACCCTCCCAAGACTAAATCAGG + Intergenic
982826042 4:160005102-160005124 CACCCTCCCAAGACTGAACCAGG + Intergenic
983030868 4:162800042-162800064 CACCCTCCCAAGACTAAATCAGG - Intergenic
983103494 4:163656334-163656356 TACCCTTCCAAGACTGAACCAGG + Intronic
983543611 4:168938738-168938760 AACCCTCCCAAGACTAAATCAGG + Intronic
984224701 4:177020638-177020660 CACCATCCCAAGACTAAACCAGG + Intergenic
985232798 4:187839265-187839287 TACCCTCCCATGACTGAACCAGG - Intergenic
985564122 5:606781-606803 TGCTATCCCAGGACTGGGTCAGG - Intergenic
985807975 5:2061289-2061311 TACCCTCCCAAGACTAAACCAGG - Intergenic
986356417 5:6931734-6931756 CACCCTCCCAAGACTGAAGCAGG - Intergenic
986656079 5:10013744-10013766 TACCCTCCCAAGACTAAACCAGG - Intergenic
986754297 5:10820683-10820705 CACCCTCCCAAGACTGAGTCAGG - Intergenic
986844048 5:11732723-11732745 TACCATCACAAGACTATAACGGG - Intronic
986979542 5:13431192-13431214 TACCTTCCCAAAACTGCACCAGG - Intergenic
987399519 5:17460712-17460734 TACCCTCCCAAGACTAAACCAGG - Intergenic
987596845 5:20012149-20012171 CACCCTCCCAAGACTGAACCAGG - Intronic
987703379 5:21430703-21430725 CACCTTCCCAAGACTCAATCAGG - Intergenic
987896670 5:23954860-23954882 CACCCTCCCAAGACTGAACCAGG - Intronic
988416373 5:30951403-30951425 TACCCTCCCAAGACTAAACCAGG + Intergenic
988871880 5:35399506-35399528 TACCCTCCCAAGACTAAACCAGG + Intergenic
989029318 5:37101813-37101835 CACCCTCCCAAGACTGAACCAGG - Intergenic
989305729 5:39953434-39953456 TATCCTCCCAAGACTGAACCAGG + Intergenic
989651396 5:43695011-43695033 CACCGTCCCAAGACTGAACCAGG - Intronic
989693607 5:44173426-44173448 CACCCTCCCAAGACTGAACCAGG + Intergenic
989820437 5:45789554-45789576 CACCCTCCCAAGACTAAATCAGG + Intergenic
989843348 5:46108934-46108956 CACCCTCCCAAGACTAAATCAGG - Intergenic
989994118 5:50807367-50807389 TAACATCCCAAGAATTGTTCAGG + Intronic
990192157 5:53271416-53271438 CACCCTCCCAAGACTAAATCAGG + Intergenic
990360131 5:55010422-55010444 CACCATCCCAAGACTGAACCAGG + Intronic
990750750 5:59013573-59013595 CACCCTCCCAAGACTAAATCAGG + Intronic
990781995 5:59375466-59375488 TACTCTCCCAAGACTGAATCAGG + Intronic
990882813 5:60558899-60558921 CACCCTCCCAAGACTAAATCAGG + Intergenic
990898016 5:60719983-60720005 CAACCTCCCAAGACTGAATCAGG + Intergenic
990899214 5:60732270-60732292 TACCCTCCCAAGACTAAACCAGG + Intergenic
990931173 5:61093974-61093996 CACCATCCCAGGACTGAACCAGG - Intronic
991227468 5:64289603-64289625 CACCCTCCCAAGACTGAACCAGG - Intronic
991324023 5:65409426-65409448 CACCCTCCCAAGACTAAATCAGG + Intronic
991363997 5:65849603-65849625 CACCCTCCCAAGACTGAACCAGG - Intronic
992183142 5:74217871-74217893 TACCTTCCCAAGACTAAATTAGG + Intergenic
992288237 5:75257742-75257764 CACCCTCCCAAGACTAAATCAGG + Intergenic
992823988 5:80529666-80529688 TACCCTCCCAAGACTAAACCAGG + Intronic
993089786 5:83411186-83411208 TACCCTCCCAAGACTGAACCAGG + Intergenic
993230535 5:85229649-85229671 CACCCTCCCAAGACTGAACCAGG - Intergenic
993263798 5:85695658-85695680 CACCTTCCCAAGACTGAACCAGG + Intergenic
993471304 5:88310715-88310737 TACCCTCCCAAGACTAAACCAGG - Intergenic
993692110 5:91014606-91014628 TACTTTCCCAAGACTGAATCAGG - Intronic
993924891 5:93854170-93854192 CACCCTCCCAAGACTAAATCAGG - Intronic
993960622 5:94292824-94292846 CACCATCCCAAGACTAAACCAGG - Intronic
994039942 5:95247103-95247125 CACCCTCCCAAGACTGAACCAGG - Intronic
994137655 5:96306160-96306182 TACCCTCCCAAGACTAAACCAGG - Intergenic
994222731 5:97215149-97215171 CACCCTCCCAAGACTGAACCAGG + Intergenic
994224532 5:97236978-97237000 CACCATCCCAAGACTAAACCAGG - Intergenic
994299090 5:98124810-98124832 CACCCTCCCAAGACTGAACCAGG + Intergenic
994308483 5:98237398-98237420 TACCCTCCCAAGACTAAACCAGG - Intergenic
994359163 5:98830826-98830848 CACCCTCCCAAGACTGAATCAGG + Intergenic
994497405 5:100530974-100530996 CACCCTCCCAAGACTGAACCAGG - Intergenic
994550970 5:101234502-101234524 CACCCTCCCAAGACTGAACCAGG - Intergenic
994707544 5:103224166-103224188 TCTCATCCCAAGACTGGAATGGG + Intergenic
994834275 5:104829325-104829347 TACCCTCCCAAGACTAAACCAGG - Intergenic
995302502 5:110600591-110600613 CACCCTCCCAAGACTAAATCAGG + Intronic
995325927 5:110889758-110889780 CACCCTCCCAAGACTGGATCAGG - Intergenic
995480688 5:112589741-112589763 TACCCTCCCAAGACTAAATCAGG + Intergenic
995602987 5:113819252-113819274 CACCCTCCCAAGACTGAACCAGG + Intergenic
995644275 5:114293905-114293927 CACCCTCCCAAGACTGAACCAGG - Intergenic
995750138 5:115445374-115445396 CACCCTCCCAAGACTAAATCAGG + Intergenic
995821934 5:116245274-116245296 TACCCTCCCAAGAGTGAACCAGG + Intronic
996006243 5:118423954-118423976 CACCCTCCCAAGACTGAATCAGG + Intergenic
996046229 5:118876661-118876683 CACCCTCCCAAGACTGAAACAGG + Intronic
996076565 5:119201781-119201803 CACCCTCCCAAGACTGAACCTGG - Intronic
996275681 5:121663337-121663359 TACCCTCCCAAGACTAAACCAGG + Intergenic
996462898 5:123767468-123767490 CACCTTCCCAAGCCTGAATCAGG - Intergenic
996663467 5:126030711-126030733 TAGCCTCCCAAGACTGAACCAGG + Intergenic
997171509 5:131726408-131726430 CACCATCCCAAGACTAAACCAGG - Intronic
997706690 5:135961077-135961099 CACCCTCCCAAGACTGAACCAGG + Intergenic
998526962 5:142851464-142851486 TACAATCTCAAGCCTGGATATGG - Intronic
998779832 5:145644225-145644247 CACCCTCCCAAGACTAAATCAGG - Intronic
998789192 5:145747454-145747476 TGCCCTCCCAAGACTAAATCAGG + Intronic
998873049 5:146571746-146571768 CACCCTCCCAAGACTGAACCAGG - Intergenic
998927126 5:147138679-147138701 CACCCTCCCAAGACTACATCAGG - Intergenic
999027921 5:148256547-148256569 CACCCTCCCAAGACTGAACCAGG - Intergenic
999688622 5:154125590-154125612 TACCCTCCCAAGACTAAACCAGG + Intronic
1000008140 5:157206599-157206621 CACCCTCCCAAGACTGAACCAGG - Intronic
1000720192 5:164696334-164696356 CACCCTTCCAAGACTGAATCAGG + Intergenic
1001076690 5:168634299-168634321 TACCCTCCCAAGACTAAACCAGG + Intergenic
1001583861 5:172819619-172819641 TGCCCTCCCAACTCTGGATCTGG - Intergenic
1001844314 5:174907806-174907828 CACCCTCCCAAGACTGAACCAGG + Intergenic
1003134595 6:3424543-3424565 TCCTCTCCCAAGACCGGATCAGG + Intronic
1003150192 6:3541558-3541580 TCCCATCCCTAGACAAGATCTGG - Intergenic
1004069565 6:12286462-12286484 TACCAACCCAAGACTAAATCAGG + Intergenic
1004805530 6:19200132-19200154 CACCCTCCCAAGACTGAACCAGG - Intergenic
1004825964 6:19421599-19421621 GACCCTCCCAAGACTGAACCAGG - Intergenic
1005208212 6:23429389-23429411 CACCCTCCCAAGACTGAACCAGG - Intergenic
1005283012 6:24294748-24294770 CACCCTCCCAAGACTGAACCAGG + Intronic
1005924005 6:30426161-30426183 CACCCTCCCAAGACTGAACCAGG + Intergenic
1007314558 6:40975961-40975983 CACCCTCCCAAGACTGAACCAGG - Intergenic
1007972798 6:46069489-46069511 CACCCTCCCAAGACTGAACCAGG + Intronic
1008254462 6:49279190-49279212 CACCATCCCAAGACTAAACCAGG + Intergenic
1008736881 6:54555862-54555884 TACCCTCCCAAGACTAAACCAGG + Intergenic
1008780029 6:55092454-55092476 CACCATCCCAAGACTAAACCAGG + Intergenic
1008962917 6:57285051-57285073 CACCCTCCCAAGACTAAATCAGG + Intergenic
1009226681 6:61026158-61026180 CACCCTCCCAAGACTAAATCAGG + Intergenic
1009246906 6:61249780-61249802 CACCCTCCCAAGACTAAATCAGG - Intergenic
1009289174 6:61863000-61863022 CACCCTCCCAAGACTGAATCAGG - Intronic
1009316576 6:62228236-62228258 TACCCTCCCAAGACTAAATTAGG - Intronic
1009336376 6:62495443-62495465 TACCCTCCCAAGACTAAACCAGG + Intergenic
1009384574 6:63072975-63072997 TACCCTCCCAAGACTGAACCAGG - Intergenic
1009476135 6:64094468-64094490 CACCCTCCCAAGACTAAATCAGG - Intronic
1009580933 6:65533261-65533283 CACCCTCCCAAGACTAAATCAGG + Intronic
1009706857 6:67263335-67263357 CACCCTCCCAAGACTGAACCAGG - Intergenic
1010493715 6:76505937-76505959 CACCCTCCCAAGACTGAACCAGG - Intergenic
1010555948 6:77279924-77279946 CACCATGCCAAGACTGAACCAGG + Intergenic
1010812143 6:80313140-80313162 CACCCTCCCAAGACTGAACCAGG - Intronic
1010948370 6:82005490-82005512 TTCCATTGCAAGACTGGAACAGG + Intergenic
1010956708 6:82098525-82098547 CACCCTCCCAAGACTGAATCAGG + Intergenic
1011006250 6:82648768-82648790 CACCATCCCAAGACTAAACCAGG + Intergenic
1011081925 6:83499071-83499093 CACCTTCCCAAGACTAAATCAGG + Intergenic
1011142900 6:84179771-84179793 CACCATCCCAAGACTAAACCAGG + Intronic
1011244734 6:85310467-85310489 CACCATCCCAAGACTAAACCAGG + Intergenic
1011250586 6:85367840-85367862 CACCATCCCAAGACTAAACCAGG + Intergenic
1011316095 6:86033098-86033120 TACCTTCCCAAGACTAAACCAGG + Intergenic
1011317709 6:86054531-86054553 CACCCTCCCAAGACTAAATCAGG - Intergenic
1011446568 6:87447890-87447912 CACCCTCCCAAGACTGAACCAGG - Intronic
1011548211 6:88503415-88503437 CACCATCCCAGGCCTGGCTCTGG + Intergenic
1011838646 6:91467675-91467697 CACCATCCCAAGACTAAACCAGG - Intergenic
1011916605 6:92513755-92513777 TCCCCTCCCAACACTGAATCAGG + Intergenic
1011966279 6:93161542-93161564 TACCATGCCCAGACTTGATCAGG + Intergenic
1012232052 6:96771527-96771549 CACCCTCCCAAGACTGAACCAGG + Intergenic
1012251245 6:96983594-96983616 CACCCTCCCAAGACTAAATCAGG - Intronic
1012336285 6:98062158-98062180 TACCCTCCCAAGACTAAACCAGG - Intergenic
1012481613 6:99673504-99673526 TACCCTCCCAAGACTAAACCAGG - Intergenic
1012490367 6:99776704-99776726 CACCCTCCCAAGACTGAACCAGG - Intergenic
1012571880 6:100739649-100739671 TACCTTCCCAAAACTAGATCAGG - Intronic
1012577005 6:100814654-100814676 TACCTTCCTAAGACTGAACCAGG - Intronic
1012640257 6:101601644-101601666 CAACCTCCCAAGACTGAATCAGG - Intronic
1012713834 6:102643917-102643939 CAACTTCCCAAGACTGAATCAGG + Intergenic
1012784299 6:103603662-103603684 CACCCTCCCAAGACTGAACCAGG - Intergenic
1012799345 6:103805265-103805287 CACCCTCCCAAGACTAAATCAGG + Intergenic
1012870406 6:104666589-104666611 CACCATCTCAAGACTGAATCAGG + Intergenic
1012878727 6:104759977-104759999 CACCATCCCAAGACTAAACCAGG + Intronic
1012941290 6:105418437-105418459 CACCCTCCCAAGACTGAACCAGG + Intergenic
1013379575 6:109554409-109554431 CACCCTCCCAAGACTGAATCAGG - Intronic
1013484144 6:110579620-110579642 CACCCTCCCAAGACTGAACCAGG + Intergenic
1013789289 6:113817499-113817521 AACCATGCCAACACTGGATAAGG - Intergenic
1014146135 6:117999877-117999899 TACCCTCCCAAGACTAAACCAGG + Intronic
1014185539 6:118430223-118430245 CACCCTCCCAAGACTAGACCAGG + Intergenic
1014332420 6:120086390-120086412 TACCCTCCCAAGACTAAACCAGG + Intergenic
1014385635 6:120798430-120798452 CACCATCCCAAGACTAGACCAGG - Intergenic
1014393264 6:120891751-120891773 CACCATCCCAAGACTAAACCAGG - Intergenic
1014424573 6:121288431-121288453 CACCCTCCCAAGACTAAATCAGG + Intronic
1014883471 6:126750848-126750870 CACCCTCCCAAGACTGAACCAGG + Intergenic
1014922723 6:127231649-127231671 CACCCTCCCAAGACTAAATCAGG + Intergenic
1015045993 6:128776927-128776949 CACCCTCCCAAGACTAAATCAGG - Intergenic
1015133325 6:129838857-129838879 CACCCTCCCAAGACTAAATCAGG + Intronic
1015247359 6:131089750-131089772 TACCCTCCCAAGACTAAACCAGG + Intergenic
1015368285 6:132422271-132422293 TAACCTCCCAAGACTGAACCAGG - Intergenic
1015501078 6:133934113-133934135 TATCCTCCCAAGACTAAATCAGG + Intergenic
1015651657 6:135468777-135468799 CACCCTCCCAAGACTGAAGCAGG + Intronic
1015659824 6:135562955-135562977 CACCCTCCCAAGACTGAACCAGG - Intergenic
1015698398 6:136007683-136007705 CACCCTCCCAAGACTGAACCAGG - Intronic
1015902191 6:138079371-138079393 CACCCTCCCAAGACTGAATCAGG + Intergenic
1015931580 6:138366092-138366114 TACCCTCCCAAGACTAAACCAGG + Intergenic
1016288701 6:142504365-142504387 CACAATCCCAAGACTGAACCAGG - Intergenic
1017390815 6:153937463-153937485 TACCCTCCCAAGACTGAGCCAGG - Intergenic
1017660273 6:156667255-156667277 CACCATCCCAAGCCTAAATCAGG + Intergenic
1018132368 6:160744372-160744394 CACCCTCCCAAGACTGAACCAGG - Intronic
1018348185 6:162925092-162925114 TACCCTCCCAAGACTAAACCAGG + Intronic
1018507544 6:164487664-164487686 TACCCTCCCAAGACTAGACAAGG - Intergenic
1018578554 6:165286206-165286228 CACCCTCCCAAGACTGAACCAGG + Intronic
1018661974 6:166096583-166096605 CACCCTCCCAAGACTGAACCAGG - Intergenic
1019167967 6:170111487-170111509 TACAAAGCCAAGACTGGAACCGG + Intergenic
1020325622 7:6972691-6972713 TACCCTCCCAAGACTAAACCAGG - Intergenic
1020585662 7:10062890-10062912 TATGGTCCCAAGACTGGATAAGG - Intergenic
1020867600 7:13587128-13587150 CACCCTCCCAAGACTGAACCAGG - Intergenic
1021215677 7:17912909-17912931 TCCCATCACAGGACTGGAGCAGG + Intronic
1021749033 7:23776543-23776565 CACCCTCCCAAGACTAAATCAGG - Intronic
1021780152 7:24096630-24096652 CACCCTCCCAAGACTGAAACTGG - Intergenic
1021916690 7:25440816-25440838 CACCCTCCCAAGACTGAACCAGG - Intergenic
1023238652 7:38118014-38118036 CACCCTCCCAAGACTGGGCCAGG - Intergenic
1023241589 7:38153699-38153721 CACCCTCCCAAGACTGAACCAGG + Intergenic
1023886002 7:44356600-44356622 CACCCTCCCAAGACTGAACCAGG - Intergenic
1024405871 7:48979280-48979302 TACCCTCCCCAGACTGAATCAGG + Intergenic
1024552346 7:50573546-50573568 CACCCTCCCAAGACTAAATCAGG - Intergenic
1024592148 7:50897480-50897502 CAACCTCCCAAGACTGAATCAGG + Intergenic
1024956101 7:54922936-54922958 CACCCTCCCAAGACTAAATCAGG + Intergenic
1024990208 7:55228499-55228521 TACCCTCCCAATACTGAACCAGG - Intronic
1025001499 7:55319238-55319260 TACCTTCCCAAGACTAAACCAGG - Intergenic
1025786422 7:64647720-64647742 CACCCTCCCAAGACTGAACCAGG - Intergenic
1027424279 7:78046838-78046860 TACCATCTCAAGACTTAATATGG - Intronic
1027506558 7:79022780-79022802 CACCATCCCAAGATTGAACCAGG + Intronic
1027574787 7:79918484-79918506 CACCCTCCCAAGACTAAATCAGG + Intergenic
1027575945 7:79931147-79931169 CACCCTCCCAAGACTGAACCAGG - Intergenic
1027697032 7:81424239-81424261 CACCCTCCCAAGACTAAATCAGG - Intergenic
1027731579 7:81881118-81881140 TACCCTCCCAAGACTAAACCAGG + Intergenic
1028218010 7:88159183-88159205 TACGTTTCCAAGACTGAATCAGG + Intronic
1028282332 7:88946814-88946836 CACCATCCCAAGACTAAACCAGG - Intronic
1028395230 7:90361843-90361865 TACCCTCCCAAGACTAAACCAGG - Intronic
1028647220 7:93111736-93111758 CACCCTCCCAAGACTAAATCAGG + Intronic
1028785707 7:94790692-94790714 CACCCTCCCAAGACTGAACCAGG - Intergenic
1029017914 7:97333479-97333501 TACCCTCCCAAGACTAAACCAGG + Intergenic
1029810365 7:103041254-103041276 CACCCTCCCAAGACTAAATCAGG + Intronic
1029919454 7:104247124-104247146 TACCCTCCCAAGACTAAACCAGG - Intergenic
1030256180 7:107511323-107511345 CACCATCCCAAGACTAAAACAGG + Intronic
1030268855 7:107649043-107649065 CACCATCCCAAGACTAAACCAGG - Intergenic
1030341898 7:108390266-108390288 TACCCTCCCAAGACTAAACCAGG - Intronic
1030403519 7:109082582-109082604 CACCCTCCCAAGACTGAACCAGG - Intergenic
1030413490 7:109212165-109212187 CACCCTCCCAAGACTGAATCAGG - Intergenic
1030736231 7:113051782-113051804 CACCATCCCAAGACTAAACCAGG - Intergenic
1030806996 7:113930903-113930925 CACCCTCCCAAGACTGAACCAGG - Intronic
1030813246 7:114002756-114002778 TACCCTCCCAAGACTGAGCCAGG + Intronic
1031182949 7:118440118-118440140 CACCTTCCCAAGACTGAACCAGG + Intergenic
1031245500 7:119306427-119306449 TACCCTCCCAAAACTGAACCAGG + Intergenic
1031254597 7:119431559-119431581 CACCCTCCCAAGACTGAATCAGG + Intergenic
1031366275 7:120904130-120904152 CACCATCCCAAGACTAAACCAGG + Intergenic
1031645870 7:124224222-124224244 TACCTGCCAAAGACTGGAGCGGG + Intergenic
1031684307 7:124713799-124713821 CACCCTCCCAAGACTGAACCAGG - Intergenic
1031864971 7:127028546-127028568 TACCTTCCCAAGACTAAACCAGG - Intronic
1032726935 7:134598684-134598706 CACCCTCCCAAGACTGAATCAGG - Intergenic
1032775326 7:135106926-135106948 CACCCTCCCAAGACTGAACCAGG - Intronic
1032942885 7:136815392-136815414 CACCCTCCCAAGACTAAATCAGG - Intergenic
1032966657 7:137105590-137105612 CACCCTCCCAAGACTAAATCAGG + Intergenic
1033791904 7:144800466-144800488 CACCCTCCCAAGACTGAACCAGG + Intronic
1035631968 8:1114411-1114433 CACCCTCCCAAGACTGAACCAGG - Intergenic
1035798432 8:2381387-2381409 CACCCTCCCAAGACTAAATCAGG - Intergenic
1036050441 8:5190429-5190451 CACCATCCCAAGACTAAACCAGG + Intergenic
1036537029 8:9660015-9660037 CACCCTCCCAAGACTGAACCAGG + Intronic
1037422006 8:18712556-18712578 CACCTTCCCAAGACTGAATCAGG + Intronic
1038656024 8:29452615-29452637 TACCCTCCCAAGACTAAACCAGG + Intergenic
1038872554 8:31511152-31511174 TAATCTCCCAAGACTGAATCAGG - Intergenic
1039154375 8:34538830-34538852 CACCCTCCCAAGACTAAATCAGG + Intergenic
1039299887 8:36197970-36197992 CACCCTCCCAAGACTAAATCAGG - Intergenic
1039563205 8:38529494-38529516 TGGAATCCCAAGGCTGGATCAGG + Intergenic
1039632490 8:39127391-39127413 CACCCTCCCAAGACTGAACCAGG - Intronic
1039754480 8:40508779-40508801 CACCCTCCCAAGACTAAATCAGG - Intergenic
1040404865 8:47089719-47089741 TGCCATGCTAAGACTGGAACTGG - Intergenic
1040635845 8:49271634-49271656 TACCCTCCCAAGACTGAACTAGG - Intergenic
1040736847 8:50518733-50518755 CACCCTCCCAAGACTAAATCAGG + Intronic
1040747965 8:50669469-50669491 CACCATCCCAAGACTAAACCAGG + Intronic
1040748416 8:50674387-50674409 CACCCTCCCAAGACTAAATCAGG - Intronic
1040993007 8:53372414-53372436 CACCCTCCCAAGACTGAACCAGG + Intergenic
1041013113 8:53563558-53563580 CACCCTCCCAAGACTGAACCAGG + Intergenic
1041051120 8:53935533-53935555 CACCCTCCCAAGACTAAATCAGG + Intronic
1041130556 8:54694532-54694554 TACCCTCCCAAGACTAAACCAGG - Intergenic
1041889163 8:62849386-62849408 TGCCCTCCCAAGACTGAATCAGG - Intronic
1041889447 8:62852168-62852190 CACCCTCCCAAGACTAAATCAGG - Intronic
1042108351 8:65352804-65352826 CACCCTCCCAAGACTGAACCAGG - Intergenic
1042473413 8:69217430-69217452 TACCCTCCCAAGATTGAACCTGG + Intergenic
1042643981 8:70965665-70965687 CACTATCCCAAGACTGAGTCAGG - Intergenic
1042644998 8:70976931-70976953 TACCCTCCCAAGACTAAACCAGG - Intergenic
1043088900 8:75873089-75873111 TACCCTCCCAAGACTAAACCAGG - Intergenic
1043190955 8:77222349-77222371 CACCCTCCCAAGACTGAACCAGG - Intergenic
1043298871 8:78702183-78702205 CACCCTCCCAAGACTGAACCAGG - Intronic
1043362913 8:79496444-79496466 CACCCTCCCAAGACTGAACCAGG - Intergenic
1043381895 8:79711467-79711489 CACCCTCCCAAGACTAAATCAGG + Intergenic
1043396888 8:79846498-79846520 CACCCTCCCAAGACTGAACCAGG + Intergenic
1043498220 8:80826356-80826378 TACCCTCCCAAGACTAAACCAGG + Intronic
1043535725 8:81202128-81202150 CACCCTCCCAAGACTAAATCAGG - Intergenic
1043725426 8:83604853-83604875 TACCCTCCCAAGACTAAACCAGG + Intergenic
1043727231 8:83626188-83626210 CACCTTCCCAAGACTGAACCAGG - Intergenic
1043805350 8:84665519-84665541 CACCCTCCCAAGACTGAAGCAGG - Intronic
1043951623 8:86316010-86316032 CACCCTCCCAAGACTGAACCAGG + Intronic
1044008751 8:86966303-86966325 TCCCACTCCAAGACTGGAGCGGG + Intronic
1044048150 8:87463803-87463825 TACCCTCCCAAGACTAAACCAGG - Intronic
1044268839 8:90215903-90215925 TACCATCCCAAATCTTGATGTGG - Intergenic
1044292467 8:90488719-90488741 TACCCTCCCAAGACTAAACCAGG - Intergenic
1044294928 8:90517184-90517206 TACCACCACCATACTGGATCAGG - Intergenic
1044405546 8:91821916-91821938 TACCCTCCCAAGACTAAACCAGG + Intergenic
1044450641 8:92332233-92332255 TACCCTCCCAAGTCTGAACCAGG - Intergenic
1044596729 8:93966541-93966563 CACCCTCCCAAGACTGAACCAGG - Intergenic
1044798650 8:95930599-95930621 CACCATCCCAAGACTAAACCAGG - Intergenic
1044905865 8:97001979-97002001 CACCCTCCCAAGACTGAACCAGG - Intronic
1045002445 8:97890075-97890097 TCCCACCCCAAGACTGGAAGTGG + Intronic
1045212838 8:100116684-100116706 CACCCTCCCAAGACTGAACCAGG + Intronic
1045798006 8:106068475-106068497 CACCCTCCCAAGACTAAATCAGG + Intergenic
1045867337 8:106883154-106883176 TACCCTCCCAAGACTAAACCAGG + Intergenic
1046486128 8:114891127-114891149 CACCCTCCCAAGACTGAACCAGG - Intergenic
1046703017 8:117422072-117422094 CACCCTCCCAAGACTAAATCAGG + Intergenic
1046735824 8:117776318-117776340 CACCCTCCCAAAACTGAATCAGG + Intergenic
1046950062 8:120011359-120011381 TACCTTCCCAGGACTGCAGCAGG + Intronic
1046968171 8:120190757-120190779 CACCCTCCCAAGACTAAATCAGG - Intronic
1048424473 8:134310224-134310246 CACCCTCCCAAGACTAAATCAGG - Intergenic
1048727542 8:137403734-137403756 TACCCTCCCAAGACTGAACAAGG + Intergenic
1049136406 8:140904711-140904733 CACCCTCCCAAGACTAAATCAGG - Intronic
1049186961 8:141260653-141260675 CACCCTCCCAAGACTAAATCAGG + Intronic
1049823346 8:144650179-144650201 CACCCTCCCAAGACTGAACCAGG + Intergenic
1050215262 9:3315803-3315825 CACCCTCCCAAGACTAAATCAGG + Intronic
1050295746 9:4203581-4203603 CACAATCCCATTACTGGATCTGG + Intronic
1050408071 9:5331026-5331048 TACCCTCCCAAGACTAAACCAGG + Intergenic
1050630360 9:7552115-7552137 CACCCTCCCAAGACTAAATCAGG + Intergenic
1050671716 9:8005080-8005102 AACCCTCCCAAGACTGAACCAGG - Intergenic
1051110541 9:13630558-13630580 CACCCTCCCAAGACTGAACCAGG + Intergenic
1051313651 9:15804967-15804989 TACCCTCCCAAGACTGAAACAGG - Intronic
1051327796 9:15991857-15991879 CACCCTCCCAAGACTAAATCAGG + Intronic
1051615522 9:19002174-19002196 TACCCTCCCAAGACTAAACCAGG + Intronic
1051832994 9:21301567-21301589 AACCCTCCCAAGACTGAACCAGG + Intergenic
1051914192 9:22188359-22188381 TACCCTCCCAAGACTGCATCAGG + Intergenic
1051996612 9:23225186-23225208 TACCCTCCCAAGACTAAACCAGG + Intergenic
1052074842 9:24128636-24128658 TAACCTCCCAAGACTGAACCAGG - Intergenic
1052707187 9:32008246-32008268 CACCCTCCCAAGACTGAACCAGG - Intergenic
1053542619 9:38990422-38990444 CACCCTCCCAAGACTGAACCAGG - Intergenic
1053580567 9:39399849-39399871 CACCCTCCCAAGACTGAACCAGG + Intergenic
1053807073 9:41813939-41813961 CACCCTCCCAAGACTGAACCAGG - Intergenic
1053845063 9:42227896-42227918 CACCCTCCCAAGACTGAACCAGG + Intergenic
1053847397 9:42253605-42253627 CACCCTCCCAAGACTGAACCAGG + Intergenic
1054102154 9:60958654-60958676 CACCCTCCCAAGACTGAACCAGG + Intergenic
1054584205 9:66948209-66948231 CACCCTCCCAAGACTGAACCAGG - Intergenic
1054623519 9:67373488-67373510 CACCCTCCCAAGACTGAACCAGG + Intergenic
1054884621 9:70182568-70182590 CACCCTCCCAAGACTAAATCAGG - Intronic
1055168631 9:73227193-73227215 CACCTTCCCAAGACTGAATTAGG + Intergenic
1055341253 9:75285921-75285943 TACCCTGCCAAGACTGAACCAGG - Intergenic
1055622060 9:78136573-78136595 TACCCTCCCAAGACTAAACCAGG + Intergenic
1056885608 9:90440824-90440846 CACCATCCCAAGACTGAACCAGG - Intergenic
1056907097 9:90662252-90662274 CACCCTCCCAAGACTGAACCAGG - Intergenic
1058036243 9:100256127-100256149 TACCCTCCCAAGACTAAACCAGG - Intronic
1058064169 9:100530514-100530536 CACCCTCCCAAGACTAAATCAGG + Intronic
1058235942 9:102490026-102490048 AAACATCCCAAGATTGAATCAGG - Intergenic
1058441601 9:105013205-105013227 TAACATCCCATGATTGAATCAGG - Intergenic
1059003910 9:110380902-110380924 TACCCTTCCAAGACTGAACCAGG - Intronic
1059262403 9:112990825-112990847 CACCCTCCCAAGACTGAACCAGG - Intergenic
1059690432 9:116680302-116680324 CACCATCCCAAGACTAAACCAGG + Intronic
1060037837 9:120272766-120272788 CACCCTCCCAAGACTAGACCAGG - Intergenic
1060336885 9:122732938-122732960 CACTGTCCCAAGACTGAATCAGG + Intergenic
1061244518 9:129394576-129394598 TTCCCTTCCAAGACAGGATCTGG - Intergenic
1061603780 9:131692796-131692818 TACCATCCCATGACTAGGTTTGG - Intronic
1062298026 9:135844797-135844819 TACCCTCCCAAGACTAAACCAGG + Intronic
1186523490 X:10226827-10226849 CACCCTCCCAAGACTGAACCAGG + Intronic
1186740702 X:12514930-12514952 CACCCTCCCAAGACTGAATCAGG - Intronic
1186772949 X:12835743-12835765 CACCCTCCCAAGACTAAATCAGG - Intergenic
1187224742 X:17364370-17364392 TAACATCCCAAGGATGGAGCAGG - Intergenic
1187286576 X:17910492-17910514 CACCCTCCCAAGACTGAACCAGG - Intergenic
1187605494 X:20877995-20878017 CACCCTCCCAAGACTGAACCAGG + Intergenic
1187644546 X:21332818-21332840 CACCCTCCCAAGACTGAAGCAGG + Intergenic
1187818491 X:23259337-23259359 CACCCTCCCAAGACTGAACCAGG + Intergenic
1188164024 X:26839083-26839105 CACCCTCCCAAGACTGAACCAGG + Intergenic
1188319270 X:28715609-28715631 CACCCTCCCAAGACTGAACCAGG + Intronic
1188454980 X:30353906-30353928 CACCCTCCCAAGACTGGACCAGG - Intergenic
1188535799 X:31195490-31195512 TACTTTCCCAAGTGTGGATCAGG + Intronic
1188768385 X:34124967-34124989 TACTCTCCCAAGACTGAACCAGG - Intergenic
1188792651 X:34423316-34423338 AACCTTCCCAAGACTGAACCAGG + Intergenic
1189186854 X:39062241-39062263 TCCCAGCCCAAGACTGGAGTAGG + Intergenic
1189188975 X:39079810-39079832 TACCCTCCTAAGACTGAACCAGG - Intergenic
1189201446 X:39199241-39199263 TCTCATCTCAAGACTCGATCTGG - Intergenic
1189581363 X:42410413-42410435 CACCCTCCCAAGACTGAACCAGG - Intergenic
1189866783 X:45338711-45338733 TACCCTCCCAAGATTGAATCAGG + Intergenic
1189894225 X:45637128-45637150 CAACTTCCCAAGACTGAATCTGG + Intergenic
1189939147 X:46103316-46103338 CACCCTCCCAAGACTGAACCAGG - Intergenic
1189940354 X:46114594-46114616 CACCCTCCCAAGACTGAAACAGG - Intergenic
1190271892 X:48871415-48871437 TACCCTCCCAAGACTAAACCAGG + Intergenic
1190523777 X:51307701-51307723 CACCCTCCCAAGACTGAACCTGG - Intergenic
1190923458 X:54879775-54879797 CACCCTCCCAAGACTAAATCAGG - Intergenic
1190967991 X:55320543-55320565 TACCCTCCCAAGACTAAACCAGG - Intergenic
1190977418 X:55419651-55419673 CACCCTCCCAAGACTGAACCAGG + Intergenic
1191003943 X:55690315-55690337 CACCATCCCAAGACTAAACCAGG + Intergenic
1191049377 X:56174809-56174831 CACCATCCCAAGACTAAACCAGG - Intergenic
1191051470 X:56197516-56197538 CACCCTCCCAAGACTAAATCAGG + Intergenic
1191071735 X:56407762-56407784 CACCCTCCCAAGACTAAATCAGG - Intergenic
1191099351 X:56708468-56708490 CACCCTCCCAAGACTGAACCAGG - Intergenic
1191138061 X:57087732-57087754 TACCCTCCCAAGACTAAACCAGG - Intergenic
1191181823 X:57572578-57572600 CACCCTCCCAAGACTAAATCAGG + Intergenic
1191203307 X:57807745-57807767 CACCCTCCCAAGACTAAATCAGG - Intergenic
1191651435 X:63542361-63542383 CACCCTCCCAAGACTGAACCAGG + Intergenic
1191695657 X:63987369-63987391 TACCCTCCCAAGACTAAACCAGG + Intergenic
1191703514 X:64068263-64068285 CACCTTCCCAAGACTGAACCAGG - Intergenic
1191704643 X:64081576-64081598 CACCCTCCCAAGACTGAACCAGG - Intergenic
1191760290 X:64639935-64639957 CAACCTCCCAAGACTGAATCAGG - Intergenic
1191765376 X:64692680-64692702 TACCCTCCCAAGACTAAACCAGG - Intergenic
1191935744 X:66425604-66425626 CACCCTCCCAAGACTGAACCAGG + Intergenic
1191994052 X:67071402-67071424 CACCCTCCCAAGAATGAATCAGG + Intergenic
1192044914 X:67661904-67661926 CACCATCCCAAGACTAAACCAGG - Intronic
1192055953 X:67773497-67773519 CACCCTCCCAAGACTGAACCAGG + Intergenic
1192101341 X:68267962-68267984 TACCCTCCCAAGACTAAACCAGG + Intronic
1192243492 X:69354169-69354191 CACCCTCCCAAGACTAAATCAGG + Intergenic
1192277194 X:69645311-69645333 CACCCTCCCAAGACTGAACCAGG - Intronic
1192293138 X:69818645-69818667 CACCTTCCCAAGACTGAACCAGG + Intronic
1192296851 X:69858944-69858966 TACCTTCCCAAGATTGAACCAGG - Intronic
1192636842 X:72827913-72827935 CACCCTCCCAAGACTAAATCAGG - Intronic
1192644872 X:72892901-72892923 CACCCTCCCAAGACTAAATCAGG + Intronic
1192684014 X:73284769-73284791 CACCATCCCAAGACTAAACCAGG + Intergenic
1192685669 X:73302345-73302367 CACCATCCCAAGACTAAACCAGG - Intergenic
1192697336 X:73431340-73431362 CACCATCCCAAGACTAAACCAGG - Intergenic
1192754848 X:74036650-74036672 TACCCTCCCAAGACTAAACCAGG - Intergenic
1192841653 X:74863554-74863576 CACCCTCCCAAGACTGAACCAGG + Intronic
1192896900 X:75453318-75453340 TACCCTCCCAAGACTAAACCAGG + Intronic
1192902491 X:75515003-75515025 CACCATCCCAAGACTAAATCAGG + Intronic
1192926831 X:75763199-75763221 CACCCTCCCAAGACTGAACCAGG + Intergenic
1192944123 X:75946740-75946762 CACCCTCCCAAGACTGAATGAGG - Intergenic
1192956784 X:76079969-76079991 TACCCTCCCAAGACTGAACAAGG + Intergenic
1192975584 X:76280693-76280715 TCCCATCCCCAGACTGGCCCCGG + Intergenic
1192998487 X:76537903-76537925 CACCCTCCCAAGACTGAACCAGG - Intergenic
1193060502 X:77201295-77201317 CACCCTCCCAAGACTGAATCAGG - Intergenic
1193189429 X:78552077-78552099 CACCCTCCCAAGACTGAACCAGG + Intergenic
1193259585 X:79389949-79389971 CACCCTCCCAAGACTGAACCAGG + Intergenic
1193309530 X:79989280-79989302 CACCCTCCCAAGACTGAACCAGG + Intergenic
1193341012 X:80349371-80349393 CACCATCCCAAGACTAAACCAGG - Intronic
1193354278 X:80499173-80499195 CACCCTCCCAAGACTGAACCAGG - Intergenic
1193458319 X:81758237-81758259 CACCCTCCCAAGACTGAACCAGG + Intergenic
1193484003 X:82063538-82063560 AACCCTCCCAAGACTGAACCAGG + Intergenic
1193637574 X:83971242-83971264 CACCCTCCCAAGACTGAACCAGG + Intergenic
1193727875 X:85064088-85064110 CACCCTCCCAAGACTGAACCAGG - Intronic
1193773585 X:85617289-85617311 TACCCTTCCAAGACTGAACCAGG - Intergenic
1193788642 X:85791463-85791485 CACCCTCCCAAGACTAAATCAGG - Intergenic
1193788813 X:85793910-85793932 CACCCTCCCAGGACTGAATCAGG - Intergenic
1193854508 X:86582640-86582662 CAACATCCCAAGATTGGACCAGG + Intronic
1193963643 X:87955944-87955966 TAACCTCCCAAGACTGAACCAGG + Intergenic
1194028270 X:88781292-88781314 TACCCTCCCAAGACTGAACCAGG - Intergenic
1194158838 X:90425857-90425879 CACCCTCCCAAGACTAAATCAGG + Intergenic
1194221005 X:91191660-91191682 CACCATCCCAAGACTGAACCAGG + Intergenic
1194264569 X:91738798-91738820 TGCCATCCCAAGAAAGCATCAGG + Intergenic
1194344602 X:92747909-92747931 CACCCTCCCAAGACTGAACCTGG - Intergenic
1194517780 X:94878180-94878202 TACCCTCCCAAGACTGAACCAGG + Intergenic
1194549416 X:95277492-95277514 CACCCTCTCAAGACTGAATCAGG + Intergenic
1194586856 X:95746007-95746029 CACCCTCCCAAGACTGAACCAGG + Intergenic
1194608285 X:96008485-96008507 TACCCCCCCAAGACTGAACCAGG + Intergenic
1194625081 X:96217946-96217968 TACCCTCCCAAGACTAAACCAGG + Intergenic
1194635339 X:96339494-96339516 CACCCTCCCAAGACTGAACCAGG - Intergenic
1194664163 X:96659121-96659143 CACCATCCTAAGACTGAACCAGG + Intergenic
1194727216 X:97412832-97412854 CACCATCCCAAGACTAAACCAGG + Intronic
1194782832 X:98046064-98046086 TACCCTCCCAAGACTAAACCAGG - Intergenic
1194798073 X:98237559-98237581 TACCTTCCCAAGACTAAACCAGG - Intergenic
1194838374 X:98709908-98709930 AACCCTCCCAAGACTGAACCAGG - Intergenic
1194867729 X:99089253-99089275 CACCCTTCCAAGACTGAATCAGG + Intergenic
1194983583 X:100465895-100465917 CACCCTCCCAAGACTGAACCAGG - Intergenic
1195417239 X:104633554-104633576 TACCCTCCCAAGACTAAACCAGG - Intronic
1195424696 X:104715193-104715215 TACCCTCCCAAGACTGAACCAGG - Intronic
1195533030 X:105979224-105979246 TACCCTCCCAAGACTGAACCAGG - Intergenic
1195729905 X:107956302-107956324 CACCCTCCCAAGACTGAACCAGG - Intergenic
1195784742 X:108506972-108506994 CACCCTCCCAAGACTGAACCAGG + Intronic
1195831356 X:109062801-109062823 CACCCTCCCAAGACTGAAGCAGG + Intergenic
1196148909 X:112350579-112350601 CACCCTCCCAAGACTAAATCAGG - Intergenic
1196152356 X:112389138-112389160 CACCCTCCCAAGACTGAACCAGG - Intergenic
1196240433 X:113337670-113337692 TACCCTCCTAAGACTGAACCAGG - Intergenic
1196382086 X:115101641-115101663 CACCCTCCCAAGACTGAACCAGG + Intergenic
1196554777 X:117073739-117073761 CACCCTCCCAAGACTGAACCAGG + Intergenic
1197107534 X:122733494-122733516 TACCCTCCCAAGACTCAACCAGG + Intergenic
1197279106 X:124514605-124514627 CACCATCCCAAGATTGAACCAGG + Intronic
1197302659 X:124800315-124800337 CACCATCCCAAGACTAAACCAGG - Intronic
1197478281 X:126950153-126950175 AACCCTCCCAAGACTAAATCAGG + Intergenic
1197575150 X:128202353-128202375 CACCCTCCCAAGACTAAATCAGG + Intergenic
1197594143 X:128446504-128446526 CACCTTCCCAAGACTAAATCAGG - Intergenic
1197913341 X:131509318-131509340 TAACCTCCCAAGACTGAACCAGG - Intergenic
1197917915 X:131556108-131556130 CACCCTCCCAAGACTGAACCAGG + Intergenic
1197959922 X:131992917-131992939 CACCATCCCAAGACTAAACCAGG + Intergenic
1198342358 X:135727207-135727229 TACCCTCCCAAGACTAAACCAGG - Intergenic
1198345632 X:135756088-135756110 TACCCTCCCAAGACTAAACCAGG + Intergenic
1198578903 X:138041925-138041947 CACCCTCCCAAGACTGAACCAGG + Intergenic
1198646127 X:138808873-138808895 CACCATCCCAAGACTAAACCAGG + Intronic
1198648363 X:138834361-138834383 CACCCTCCCAAGACTGAATTAGG - Intronic
1198654072 X:138894587-138894609 CACCATCCCAAGACTAAACCAGG + Intronic
1198663789 X:138999614-138999636 CACCCTCCCAAGACTAAATCAGG + Intronic
1198687396 X:139241461-139241483 CACCCTCCCAAGACTGAATCAGG + Intergenic
1198704989 X:139439103-139439125 CACCCTCCCAAGACTGAACCAGG + Intergenic
1198786017 X:140288964-140288986 CACCCTCCCAAGACTGAACCAGG - Intergenic
1198958191 X:142155440-142155462 CACCCTCCCAAGACTGAACCAGG - Intergenic
1198974793 X:142324213-142324235 CACCCTCCCAAGACTGAACCAGG - Intergenic
1199071495 X:143480791-143480813 TACACTCCCAAGACTGAACCAGG - Intergenic
1199098648 X:143771413-143771435 CACCCTCCCAAGACTGAACCAGG + Intergenic
1199318526 X:146410575-146410597 CACCCTCCCAAGACTGAACCAGG + Intergenic
1199348899 X:146776331-146776353 CACCCTCCCAAGACTGAACCAGG - Intergenic
1199379809 X:147157122-147157144 CACCCTCCCAAGACTGAGTCAGG + Intergenic
1199436919 X:147822829-147822851 CACCCTCCCAAGACTAAATCAGG + Intergenic
1199437607 X:147830230-147830252 CACCCTCCCAAGACTGAAACAGG + Intergenic
1199483947 X:148328179-148328201 CACCCTCCCAAGACTAAATCAGG - Intergenic
1199561209 X:149164643-149164665 CACCCTCCCAAGACTGAAACAGG + Intergenic
1199589071 X:149449181-149449203 CACCCTCCCAAGACTGAACCAGG - Intergenic
1199786295 X:151108688-151108710 TAACCTCCCAAGACTGAACCAGG - Intergenic
1200344058 X:155430950-155430972 TACCCTCCCAAGACTAAACCAGG + Intergenic
1200371112 X:155725532-155725554 CACCCTCCCAAGACTAAATCAGG - Intergenic
1200372634 X:155743245-155743267 CACCCTCCCAAGACTGAACCAGG + Intergenic
1200388184 X:155915075-155915097 CACCCTCCCAAGACTGAACCAGG - Intronic
1200557510 Y:4655413-4655435 CACCATCCCAAGACTGAACCAGG + Intergenic
1200652950 Y:5864547-5864569 CACCCTCCCAAGACTGAACCTGG - Intergenic
1200739967 Y:6843571-6843593 TACCCTCCCAAGACTAAACCAGG - Intergenic
1200888038 Y:8291430-8291452 AACCCTTCCAAGACTGGACCAGG - Intergenic
1201186361 Y:11407593-11407615 CACCATCCCAGGACTAAATCAGG + Intergenic
1201364566 Y:13189461-13189483 TACCCTCCCAAGACTAAATCAGG + Intergenic
1201371172 Y:13266226-13266248 CACCCTCCCAAGACTAAATCAGG - Intronic
1201619796 Y:15943690-15943712 TACCTTCCCAAGACTAAACCAGG - Intergenic
1201647333 Y:16249902-16249924 CACCCTCCCAAGACTAAATCAGG + Intergenic
1201655478 Y:16335399-16335421 CACCCTCCCAAGACTAAATCAGG - Intergenic
1201974769 Y:19836816-19836838 CACCCTCCCAAGACTAAATCAGG - Intergenic
1202077381 Y:21050480-21050502 CACCATCCCAAGACTAAACCAGG - Intergenic