ID: 1096941910

View in Genome Browser
Species Human (GRCh38)
Location 12:55355882-55355904
Sequence GGGTCAGATTGCCTCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096941905_1096941910 4 Left 1096941905 12:55355855-55355877 CCCAGCACAACGCTCAAGCTCTG No data
Right 1096941910 12:55355882-55355904 GGGTCAGATTGCCTCCTCAAGGG No data
1096941906_1096941910 3 Left 1096941906 12:55355856-55355878 CCAGCACAACGCTCAAGCTCTGC No data
Right 1096941910 12:55355882-55355904 GGGTCAGATTGCCTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096941910 Original CRISPR GGGTCAGATTGCCTCCTCAA GGG Intergenic
No off target data available for this crispr