ID: 1096950772

View in Genome Browser
Species Human (GRCh38)
Location 12:55467362-55467384
Sequence TTTCACCCAAATTCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096950770_1096950772 8 Left 1096950770 12:55467331-55467353 CCATACTCTACTAGGTGGAGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096950772 Original CRISPR TTTCACCCAAATTCAAAGAA AGG Intergenic
904469079 1:30724727-30724749 CTTGACCCAAATGCAAAGAAGGG - Intergenic
905010737 1:34745455-34745477 TTTTACCCAGATTCACAGACAGG + Intronic
908475233 1:64480885-64480907 TTTCACCCAAAAAAAAAAAAAGG - Intronic
908610036 1:65847861-65847883 CTTCATCCAAATTAAATGAATGG + Intronic
908610046 1:65848014-65848036 CTTCATCCAAATTAAATGAATGG + Intronic
908866967 1:68559106-68559128 TGTAACCCACATTCAGAGAAAGG + Intergenic
909406448 1:75295649-75295671 TTTCACCAATATTCAAACATTGG - Intronic
910308920 1:85800886-85800908 TTTCACCAAAACTCAAAAAGAGG + Intronic
911827198 1:102501876-102501898 TATCATCTAAATTCACAGAATGG - Intergenic
912275300 1:108251493-108251515 TTTCACTCAAATGAAAGGAAAGG - Intergenic
912292923 1:108442856-108442878 TTTCACTCAAATGAAAGGAAAGG + Intronic
912466812 1:109880198-109880220 TTTCACCCAAGTTCATGCAATGG - Intergenic
913568837 1:120100429-120100451 TGTCATCCAAGTTGAAAGAATGG + Intergenic
914265063 1:146031503-146031525 TTTCACCCAAACTCAGTGAGTGG - Intergenic
914289655 1:146261450-146261472 TGTCATCCAAGTTGAAAGAATGG + Intergenic
914550691 1:148712203-148712225 TGTCATCCAAGTTGAAAGAATGG + Intergenic
917181593 1:172303581-172303603 ATTCACCAAAGTTCAAATAAAGG + Intronic
917830318 1:178876463-178876485 TTTCTCACAGATTCCAAGAAAGG - Intronic
918269483 1:182883345-182883367 TTTTCACCAAATACAAAGAAGGG - Exonic
918299584 1:183190609-183190631 CTTCCCCCACATTCAAAGAAAGG + Intronic
919191455 1:194226065-194226087 TTTGACCTAAATTCAATAAAAGG + Intergenic
919320486 1:196030742-196030764 TATCACCCAAAGACAAAAAAGGG - Intergenic
921912358 1:220563630-220563652 TTTCACCCAACTACACAGAGGGG - Intronic
1063847100 10:10142245-10142267 TTTCATCCCCATTCAAAAAAGGG + Intergenic
1063995711 10:11616760-11616782 TTTCATCAAAATTAACAGAAGGG + Intergenic
1064175479 10:13071586-13071608 TTTCACCCATGTTAAAAGGAGGG - Intronic
1064862102 10:19837933-19837955 TTTCACCAAAATGCAAGTAATGG - Intronic
1065162239 10:22934645-22934667 GTTCACCCAAGTTCATAGATGGG - Intronic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1067011094 10:42714570-42714592 TTTCTCCTACATTGAAAGAAAGG + Intergenic
1067212344 10:44270005-44270027 ATTCACCAAAATTGAAATAAAGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1068839721 10:61597011-61597033 TATCACCCAAAATCAAAACAAGG - Intergenic
1068881012 10:62048819-62048841 TTTCACCAAAATGCTAGGAAGGG + Intronic
1069170018 10:65215461-65215483 TATCACCAAAGTTCAAAGGAGGG + Intergenic
1069976923 10:72221228-72221250 TTTTAGCCCAATTAAAAGAAAGG - Intronic
1070719595 10:78746920-78746942 TTCCAACCAGATCCAAAGAAGGG + Intergenic
1071356487 10:84801577-84801599 TTGCAGCCAAACACAAAGAAAGG - Intergenic
1074207693 10:111298283-111298305 GTCCACCCAGATTCAGAGAAAGG - Intergenic
1075992021 10:126846291-126846313 TTTCTCCCCAATTAAATGAATGG - Intergenic
1076717823 10:132375426-132375448 TTTCAGCCGTATTAAAAGAAAGG + Exonic
1079315577 11:19405327-19405349 TTTCACCCAAATTCTGACATTGG + Intronic
1079682341 11:23313743-23313765 TCTCACCCACACTCAAGGAAAGG + Intergenic
1079931769 11:26572401-26572423 TTTCACCCTAAGTGAAAAAAAGG + Intronic
1082896624 11:58198307-58198329 TATCCCCCAAATTACAAGAATGG - Intergenic
1083222257 11:61260251-61260273 TTTCACCAAAATTTAAAAAAAGG + Intronic
1085197440 11:74681078-74681100 ATTCACATAAATTCACAGAATGG - Intergenic
1087096591 11:94325088-94325110 TTTTATCCAAATCCAACGAAGGG - Intergenic
1087982336 11:104631434-104631456 TTTCATTCAAATTCAAGTAAGGG - Intergenic
1088121990 11:106380691-106380713 TTTCAGTCAAAATAAAAGAAAGG - Intergenic
1088198989 11:107309496-107309518 TTTTAACCAAATTCAATCAATGG + Intergenic
1089327062 11:117664582-117664604 TTTCACCTCAATTTAAAAAAGGG + Intronic
1092643649 12:10545439-10545461 TTTTTCCCAAATCCAGAGAAAGG + Intergenic
1092668594 12:10836109-10836131 TTTCAGCCAAAGACAGAGAAGGG - Intronic
1093283599 12:17228873-17228895 TTTCACACAATTTATAAGAAAGG - Intergenic
1094304111 12:28998553-28998575 TTTCACCCCAATGCAGAGGAAGG - Intergenic
1094325714 12:29236328-29236350 TTACACCCTAAGCCAAAGAAGGG + Intronic
1094474556 12:30831389-30831411 GTTAACCCAATTTCATAGAAAGG - Intergenic
1095357082 12:41287807-41287829 TTCTACCCAAATTCACTGAAGGG - Intronic
1095782387 12:46073986-46074008 TTTCACCCAAGGGCAAGGAATGG + Intergenic
1096484425 12:51968566-51968588 CTCCACCCAAATTCAAGGAAGGG - Intronic
1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG + Intergenic
1097484966 12:60185253-60185275 TTTCACCCACACTCAAAGGGAGG + Intergenic
1097497018 12:60352662-60352684 TTCCAGCCAAATTCAGAGTAAGG + Intergenic
1097579655 12:61439132-61439154 CTTCTACCAAATTCAAAAAATGG - Intergenic
1098060839 12:66560638-66560660 TCTCACCCCAGTTAAAAGAAAGG + Intronic
1100033949 12:90227801-90227823 TTTCAGCCAAAGGCCAAGAAAGG + Intergenic
1100508510 12:95244535-95244557 TATCACCCAAATGCAACGTAGGG - Intronic
1101139447 12:101779982-101780004 TTTTGCCCAAATTAAAAGTAAGG + Intronic
1101237854 12:102807373-102807395 TTTCACCCAAAGTCGTACAAAGG - Intergenic
1101299267 12:103461130-103461152 TTTCACCATAATTCAATAAATGG - Intronic
1101571322 12:105956567-105956589 TTCCATGAAAATTCAAAGAAAGG + Intergenic
1102114350 12:110390591-110390613 ATTCACACTAATTCAAACAATGG + Intronic
1104197853 12:126558299-126558321 TTTCATCCAAGTTGAGAGAAAGG - Intergenic
1105556779 13:21454587-21454609 TTAAACCCAAAGTAAAAGAAAGG + Intronic
1106473379 13:30077328-30077350 TATCTTCCAGATTCAAAGAAGGG - Intergenic
1106795319 13:33199179-33199201 TTTAAATCCAATTCAAAGAATGG - Intronic
1107538337 13:41359101-41359123 TTTAACCCATATCCTAAGAATGG + Intronic
1109114553 13:58364770-58364792 TCTCATCCAAGTTCACAGAAAGG + Intergenic
1109362285 13:61310411-61310433 TTTCAAACAAATTCAAACTATGG - Intergenic
1109369904 13:61410137-61410159 TTTAATCCAAAACCAAAGAAAGG + Exonic
1109432359 13:62252232-62252254 TTTCAACCAGAGTTAAAGAAAGG + Intergenic
1109516394 13:63448638-63448660 TTTCTCCTGAATTCAAAGGATGG - Intergenic
1110569329 13:76987965-76987987 TTTTCACCAAATGCAAAGAAGGG - Intergenic
1110569624 13:76990372-76990394 TTTTCACCAAATACAAAGAAGGG - Intergenic
1110948173 13:81450875-81450897 TTTCTTCCAAATTCAGAGGAAGG - Intergenic
1111698418 13:91655731-91655753 TTTCCCCCAAAGTCAAACATAGG - Intronic
1112108489 13:96268162-96268184 TTTCCCCAAAATTCATAGATTGG - Intronic
1112975975 13:105318011-105318033 TATCACAGAAATACAAAGAATGG + Intergenic
1115734910 14:36315759-36315781 TTTCCCACAAAGTCAATGAATGG + Intronic
1116920936 14:50573507-50573529 TTTCAACCAAGTTCAAAGCATGG - Intronic
1117814271 14:59581268-59581290 TTTGACCCAACTACCAAGAATGG - Intergenic
1118752285 14:68816171-68816193 TTTGCCCCATATTCAAAGAGCGG - Intergenic
1120353751 14:83400956-83400978 TTTCACCTTAATTCAAACCAAGG + Intergenic
1120694697 14:87631587-87631609 CTCCACCCAAATTCACAGAAAGG + Intergenic
1120991593 14:90382445-90382467 TTTCACCCATATCCACTGAAGGG + Intergenic
1121991155 14:98558974-98558996 TATCACCCAAAGGCTAAGAATGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1125483154 15:40094186-40094208 TTTCTCCCAAATTCCACTAATGG + Intronic
1125522178 15:40354450-40354472 CTTCCCCCAAATGAAAAGAAGGG + Intronic
1126154488 15:45552699-45552721 ATCCACCCAGATTCAAAGGAAGG - Intergenic
1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG + Intronic
1127781519 15:62320555-62320577 TTTCAGCCAAATCCAAATCATGG + Intergenic
1128620742 15:69147467-69147489 TTTCACCCAGGATCAAAGGAGGG + Intergenic
1131241844 15:90751462-90751484 TTTCACTCATATTTAAATAAGGG - Intronic
1131984606 15:98029411-98029433 TTTCCCACAGATCCAAAGAAGGG - Intergenic
1135408621 16:22216515-22216537 TTTAACACGAATTCAGAGAAGGG - Intronic
1136502964 16:30682853-30682875 TTTCTCCCATATGGAAAGAAAGG + Intergenic
1139832150 16:69808706-69808728 CTACACCCAAATACAAAGACAGG - Intronic
1143281275 17:5756371-5756393 TTGCACCCACAAGCAAAGAATGG - Intergenic
1143806591 17:9433608-9433630 TTTCCCCCACATACAAAAAATGG - Intronic
1143947642 17:10608004-10608026 TTTCTCCCAAATTTAAAAACTGG + Intergenic
1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG + Intronic
1146739306 17:35267985-35268007 TTTCACATGAATTCAATGAAGGG + Exonic
1150776395 17:68085080-68085102 TTTCTCACCAATTTAAAGAAGGG + Intergenic
1151005851 17:70435177-70435199 TTTTACCCAGATTCAGACAATGG - Intergenic
1153681947 18:7509238-7509260 TTCCACCCACACTCAAGGAAGGG - Intergenic
1156222831 18:35070874-35070896 TTTCCCACAAATGAAAAGAAGGG - Intronic
1156426005 18:37013443-37013465 TGTCACCCAGATACTAAGAATGG + Intronic
1157637862 18:49179058-49179080 TTTCATCAACACTCAAAGAAGGG - Intronic
1157934003 18:51854336-51854358 ATTTACCCCAATTCAAAGATAGG + Intergenic
1158591094 18:58779499-58779521 TTTCACCTATATTCAAATACTGG + Intergenic
1159926752 18:74276427-74276449 TTTCTCCCAAATTCTCAAAAGGG - Intronic
1160061453 18:75532594-75532616 TTTCACCAATATTCAAATTATGG - Intergenic
1164389726 19:27807242-27807264 TAACACACAAATTCAAAGATTGG + Intergenic
1166121147 19:40687585-40687607 TCTCAGCCACATACAAAGAACGG + Intronic
1166225395 19:41392025-41392047 CCTCACCCAAATTCCCAGAAAGG + Intronic
925420631 2:3707850-3707872 TTTCAGCAATATTCAGAGAAGGG - Intronic
927032128 2:19131915-19131937 CTGCACCAAAATTCAAAGAAAGG + Intergenic
928392327 2:30919099-30919121 TTCCATCCCAATTTAAAGAAAGG - Intronic
929327887 2:40639790-40639812 TGTTACCCAAAGGCAAAGAATGG - Intergenic
931290327 2:60867457-60867479 TTTGGCCCAAATTCAAAGGGAGG + Intergenic
931291796 2:60880760-60880782 TTTCACACAGATGCCAAGAAAGG - Intergenic
932528142 2:72495496-72495518 TTTGGCACAAATTCAGAGAAAGG + Exonic
934631210 2:95925129-95925151 TTCCATCCAAATTCAATGTAGGG + Intronic
935918884 2:107987602-107987624 TTTCAAACAACTTCAGAGAATGG - Intronic
937214678 2:120304206-120304228 TTTCACACACATTTCAAGAAGGG - Intergenic
938170753 2:129073767-129073789 TTTCACCTAATATCAAAGGAAGG + Intergenic
939625084 2:144467176-144467198 TTTTACCACAATTCAAAGACAGG - Intronic
939630509 2:144522762-144522784 TTTCACCCCAAATCAAATACTGG - Intronic
939757833 2:146136301-146136323 TTTCACACAAATTCACAAAAAGG + Intergenic
939785268 2:146502193-146502215 ATTTGCCCAAATTCAAAGAGTGG + Intergenic
940325844 2:152424090-152424112 TATCTTCCAAATTCAGAGAAAGG - Intronic
940334145 2:152507355-152507377 ATACAACCTAATTCAAAGAAGGG - Intronic
940962901 2:159804845-159804867 TATCACCCTAATTAATAGAATGG - Exonic
941058527 2:160816974-160816996 TTTGGCCCAAAGTCAAAGGAAGG + Intergenic
941637038 2:167945922-167945944 TTTGACCCATATTCAAGAAATGG - Intergenic
943840598 2:192575019-192575041 TCTCACCCACATTCAACGGAAGG + Intergenic
943913760 2:193601896-193601918 ATACTCCCATATTCAAAGAAGGG - Intergenic
946192079 2:218012843-218012865 TTTCACCAAAATTCACATATGGG + Intergenic
946594325 2:221289398-221289420 TATAACCCAAATTCAAAGTGGGG + Intergenic
948120832 2:235529198-235529220 TTTCCACCATATTCACAGAAAGG - Intronic
948552832 2:238785984-238786006 TTAAACCCAAATTTAAAAAAAGG + Intergenic
1169098082 20:2921365-2921387 GTGTACCCAAATTCAAGGAAGGG - Intronic
1170252646 20:14302385-14302407 TTTCACTCACATTCAAAGGGAGG + Intronic
1171502283 20:25603314-25603336 CTTCACCCAAACCCAGAGAATGG + Intergenic
1171774592 20:29353422-29353444 TTTTACACACTTTCAAAGAATGG + Intergenic
1177994041 21:28073445-28073467 TTTTCCCCAAATTAAAAAAATGG - Intergenic
1178173393 21:30068500-30068522 TTTCTTCCTAATTCAAGGAAGGG - Intergenic
1178354974 21:31903143-31903165 CTTGACCCAAATTCAGAGCATGG + Intronic
1178542841 21:33469526-33469548 GTTGACCCAAATTCAAAGGTAGG - Intronic
1180126248 21:45792199-45792221 TTTCTCCCACTTTCAAATAAAGG - Intronic
949136904 3:578120-578142 TTTCACCAAAAATGAATGAAAGG + Intergenic
949737886 3:7195373-7195395 AGGCACCCCAATTCAAAGAAAGG + Intronic
949841219 3:8322195-8322217 TTTCAAACAAATTACAAGAAAGG + Intergenic
950976670 3:17253874-17253896 TTTCAACCAAATGCAGAGAGAGG + Intronic
951369760 3:21830890-21830912 ATTCACCCAAGTTCACTGAAGGG + Intronic
954917647 3:54162586-54162608 TTCCACCCAACTTCAAGGTAGGG + Intronic
955123743 3:56088447-56088469 TTCATCCCAAATCCAAAGAAGGG + Intronic
955521701 3:59781555-59781577 TTTCACTATAATTCAAAGAAAGG + Intronic
956427740 3:69154553-69154575 TTCCACCCAACTTCAGAAAAAGG + Intergenic
957257233 3:77853990-77854012 TGAGACCCAAAATCAAAGAATGG + Intergenic
957819100 3:85346263-85346285 TTTAAAACAAATTCAAACAATGG - Intronic
959256090 3:104016512-104016534 TTTCAGCCAAATTCAGGGAAGGG - Intergenic
959594190 3:108111261-108111283 TTACACAGAAATTTAAAGAATGG + Intergenic
959758328 3:109926271-109926293 GTCCACCCAAATTCAAGGGAAGG - Intergenic
959823967 3:110770824-110770846 TTTCAGACCAAGTCAAAGAATGG + Intergenic
959833815 3:110895087-110895109 TTTCAAACAAATTCATAGATTGG + Intergenic
961719190 3:128880990-128881012 ATTCAGCCAAGTTCAAAGTAGGG - Intronic
963350306 3:144143108-144143130 TTTCACTGAGATTCAAAAAAGGG + Intergenic
965245445 3:166261307-166261329 ATTCACACAAATTCACATAAAGG - Intergenic
966509882 3:180749856-180749878 TTTCACACACATTAAAAGGAGGG + Intronic
966673725 3:182561605-182561627 TTTCACCCACATTGGAACAATGG - Intergenic
966795605 3:183710673-183710695 TTACACCAAAAGTCAAAGAGAGG + Intronic
968754890 4:2410093-2410115 TTTCACCTCAATTTAAAAAAAGG - Intronic
969617316 4:8261421-8261443 TGTAGCACAAATTCAAAGAAAGG - Intergenic
970420824 4:15904466-15904488 GTCTAACCAAATTCAAAGAATGG - Intergenic
970594634 4:17588994-17589016 ATTCACCAAAATACAAAGCACGG - Intronic
971950360 4:33337001-33337023 TTCTACCAAAATACAAAGAAGGG - Intergenic
972865228 4:43224091-43224113 TTGAAACCAAAATCAAAGAATGG + Intergenic
975249043 4:72155909-72155931 TTTCCCACACATTCAAAGACAGG - Intergenic
977501429 4:97843717-97843739 TTTCAACCTACTTCAAAGGAAGG + Intronic
979120255 4:116890208-116890230 TGTGACCCAACTTCAAAGATAGG + Intergenic
981045386 4:140259984-140260006 TTTGACCCAACCTCAAGGAATGG - Intronic
981799913 4:148643712-148643734 TTTCCCCCAAATTACAACAAAGG + Intergenic
982972115 4:162002240-162002262 TTTCAAAAAAATTCAGAGAAAGG + Intronic
983258214 4:165426070-165426092 CTTCAGCCAAATTAAAATAATGG + Intronic
983280840 4:165679220-165679242 TTTCAAACTAACTCAAAGAAGGG - Intergenic
983437658 4:167735303-167735325 TTTCAGCAAAACTTAAAGAAAGG - Intergenic
985121011 4:186642135-186642157 TTTCATCCCAATGCAATGAATGG + Intronic
985614917 5:914240-914262 TTTCAAACAAATACAAATAACGG - Intronic
985624196 5:976639-976661 TTTTACCAAAATTTAAAAAATGG + Intergenic
985939404 5:3122328-3122350 TTTCAATAAAATTCAAAGTAAGG + Intergenic
986784625 5:11102907-11102929 TTTAAAGCAAATCCAAAGAAAGG - Intronic
987223018 5:15810104-15810126 TTTCACATAAATTGAAAAAAAGG - Intronic
987396931 5:17432860-17432882 TCTCTCCCAAATTCAAGCAAAGG - Intergenic
988510600 5:31861500-31861522 TTTCTTCCAACTTCAAAGGAAGG + Intronic
989697084 5:44213860-44213882 CTTCACCCAACTTCAAATACAGG - Intergenic
990640028 5:57772671-57772693 TCACACCTAAATTCAAAGGAAGG - Intergenic
991437528 5:66612100-66612122 TTTAACCCAAATTCACAGGCTGG + Intronic
992658287 5:78932092-78932114 TTTCACCCAATTCCAAAAGATGG + Intronic
993625132 5:90214917-90214939 TTTCCCCCAAAATCAAGGATGGG + Intergenic
994580535 5:101635753-101635775 TTTTACTCAACTTCAAAGAAAGG - Intergenic
996457410 5:123700369-123700391 TCTTACCCAAATTCAAATAGTGG + Intergenic
996483301 5:124000188-124000210 TCTTACCAAAATTCAAAGCAGGG + Intergenic
1000107599 5:158075186-158075208 TTTCTTTCAAATTCTAAGAAGGG + Intergenic
1000856020 5:166399205-166399227 TTTCACCCAACTTTATGGAAAGG + Intergenic
1001070603 5:168581638-168581660 ATTCACACAAATTCAAATATTGG + Intergenic
1001786727 5:174419986-174420008 TTTCACTCAAGTTAAAAAAAAGG + Intergenic
1002763775 6:222016-222038 CTTCAGCCAAATTAAATGAAAGG + Intergenic
1003488059 6:6596629-6596651 TTTGGCCCAAATTTAAAGAGAGG + Intronic
1003948997 6:11100750-11100772 TTTCACCCAAAATTTAAAAATGG + Intronic
1003958553 6:11188879-11188901 TCTCAGTCAAATTAAAAGAATGG + Intronic
1005190800 6:23221125-23221147 CATCACCAAAATTCAAATAAGGG - Intergenic
1006551256 6:34825014-34825036 TATCACCCAAATATAAAGTATGG - Intronic
1006763767 6:36486776-36486798 TTTCTCCCAAAATCACAGCATGG - Intronic
1006992227 6:38225123-38225145 TTGTACCAAAATTCAAAGGACGG + Intronic
1007266266 6:40598645-40598667 TTCCACCTCAATACAAAGAATGG + Intergenic
1008059583 6:46983432-46983454 TTTCAACTAAATGCAGAGAATGG + Intergenic
1010510434 6:76712170-76712192 TTGCACCCAAACTCAAGGAGAGG - Intergenic
1011166191 6:84449559-84449581 TTACAGCTAAATTCAATGAAAGG + Intergenic
1011680677 6:89780469-89780491 TTACACACAAATACAAAGAGGGG - Intronic
1012773148 6:103466948-103466970 TTTCAAGTAAATTCAAATAATGG - Intergenic
1014337575 6:120156455-120156477 TTTAACTGAAATTCAAAAAAAGG - Intergenic
1015738653 6:136429222-136429244 TTTGACCCCACTTCATAGAAAGG + Intronic
1015845872 6:137520093-137520115 TTTCAACCAAAACCAAAAAAAGG - Intergenic
1015952907 6:138572065-138572087 TGTCACCCAATTAAAAAGAAAGG + Exonic
1016093552 6:140008433-140008455 TTTGACCAAAATACATAGAAAGG + Intergenic
1016368664 6:143346357-143346379 TCTGACCTAAATTCAAAGTAAGG + Intergenic
1016658489 6:146547274-146547296 TTTCAGGCAAATTGAAAGACTGG + Intronic
1017221904 6:151975246-151975268 CTTCACACAAAGTAAAAGAATGG + Intronic
1017553679 6:155539937-155539959 TTTCATCCAAACACAATGAAAGG - Intergenic
1018732788 6:166665391-166665413 TGTCACCCAAACCCAAAGAAGGG + Intronic
1019841170 7:3446481-3446503 TTCTACTCAAAGTCAAAGAAAGG - Intronic
1020595068 7:10196392-10196414 TCCCACACAACTTCAAAGAAAGG + Intergenic
1021442967 7:20699974-20699996 TTTAACTCAAATAGAAAGAATGG - Intronic
1022351265 7:29567492-29567514 TATCAGCCAAATTCGAGGAAGGG + Intergenic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1024108858 7:46124192-46124214 TTTCACCCATATGCAGAGGATGG - Intergenic
1025603506 7:63022533-63022555 TTTCACCCAATTTTAGAGATAGG - Intergenic
1026133455 7:67639156-67639178 TTTTATCCAAACTCAAAGAGAGG - Intergenic
1026175950 7:67997186-67997208 TTTAACCCAAGTGCAAAGAATGG - Intergenic
1026598168 7:71751915-71751937 TTGCAGCCAAAACCAAAGAAAGG - Intergenic
1027174865 7:75896885-75896907 TTTCACACATTTTCAAAGGATGG + Intergenic
1027491330 7:78831077-78831099 TTTTCCCCAAATTCAGAGCAAGG + Intronic
1027537423 7:79421944-79421966 TTTCACTGAGATTCAAACAAAGG + Intronic
1028512301 7:91638729-91638751 TTAGACCCAAACACAAAGAAAGG + Intergenic
1029324922 7:99797874-99797896 TATCAACCAAATACAAAGAAAGG + Intergenic
1031131919 7:117842686-117842708 ATTCACCTAAAATCAAAAAATGG + Intronic
1031387229 7:121166479-121166501 TTTAACTGAAATTCAAAAAAAGG - Intronic
1033712433 7:143961806-143961828 CTTCAGCCAAAGTCAATGAAGGG + Intergenic
1034975520 7:155447073-155447095 TTACCCCCAAATTCAACAAATGG - Intergenic
1036055590 8:5249940-5249962 TAATTCCCAAATTCAAAGAATGG - Intergenic
1037365693 8:18119712-18119734 TTTCACTGAAAGTCTAAGAAGGG + Intergenic
1038486462 8:27938580-27938602 TTTCCCTTAAATGCAAAGAAAGG - Intronic
1040380800 8:46869651-46869673 TTGCAACCCAATTCAAGGAAGGG + Intergenic
1041283022 8:56230420-56230442 TTCCACCCAAATTAAAACAATGG + Intergenic
1041760685 8:61362906-61362928 TTTCACCCACATTCAGAAATCGG - Intronic
1042652356 8:71057421-71057443 TGTCTCCCAAATTCAATCAAAGG + Intergenic
1043626262 8:82263263-82263285 TTTCATCAAAAATTAAAGAAGGG - Intergenic
1044446080 8:92277702-92277724 TTTTCCCCATATTCAAAAAATGG + Intergenic
1046420079 8:113970001-113970023 TTTCTGCCAAATGCAAATAAAGG - Intergenic
1046501653 8:115085503-115085525 TCTCACCTAAAATCAGAGAAGGG + Intergenic
1047223083 8:122934575-122934597 TTGCACCCAAATGCCATGAAGGG - Intronic
1047717560 8:127609765-127609787 TTCCACTTAAATTCAAAGGAAGG + Intergenic
1047825158 8:128565330-128565352 TTTCAACCAAATGGAAAGGATGG + Intergenic
1048277290 8:133076566-133076588 TTTCCCCCAAATTCACACAGAGG + Intronic
1048744971 8:137604315-137604337 TTTTACTCATCTTCAAAGAAAGG - Intergenic
1049616811 8:143579111-143579133 TTTCACCCCAATGCAAACACGGG + Intergenic
1050126120 9:2357854-2357876 TCTCACCAAAATAAAAAGAATGG + Intergenic
1050347592 9:4707772-4707794 TTTCTACCAAATTGAGAGAATGG + Exonic
1050929708 9:11307900-11307922 TTTCACCCATGTTAACAGAAGGG - Intergenic
1051136803 9:13932081-13932103 TTTTACCTCAATTGAAAGAATGG - Intergenic
1051158942 9:14183865-14183887 TTTAACCCACACTTAAAGAATGG - Intronic
1051232551 9:14967707-14967729 TTTCTCCCCAAATCACAGAAGGG - Intergenic
1052376509 9:27723875-27723897 TATCACAGAAATTCAAAGGAGGG - Intergenic
1052481943 9:29041284-29041306 TTCTACCAAAATTCAAGGAAGGG + Intergenic
1054733960 9:68731756-68731778 TATAACCCAAATTTGAAGAAAGG + Intronic
1054741700 9:68812304-68812326 TTTCACTCAATTTGAGAGAAGGG - Intronic
1055217474 9:73883961-73883983 TTTCACTCAGATTCATAGGAAGG - Intergenic
1055812155 9:80161764-80161786 AATGACCCAAATTCAAAGATAGG - Intergenic
1055898886 9:81211907-81211929 TTTCCCACAAATTCAATGACTGG - Intergenic
1057131920 9:92660058-92660080 TTCCACCAAAATTTAAGGAAAGG + Intronic
1057438432 9:95063613-95063635 TATCAACCAAACTCAAAGCAGGG - Intronic
1058269112 9:102947424-102947446 ATTCACTCATATTCAAAAAAAGG + Intergenic
1058406580 9:104683198-104683220 TATAACCCAAAATCAAACAAAGG + Intergenic
1186296576 X:8155305-8155327 TTTCTTCCTAAGTCAAAGAATGG + Intergenic
1186585336 X:10867351-10867373 TTTGACCCCACTTCAAAGACTGG + Intergenic
1186875333 X:13810911-13810933 TTTGAGCCAAATTTAAATAAAGG + Intronic
1187306287 X:18098394-18098416 TTTGACAGAAATTCACAGAATGG - Intergenic
1187641441 X:21295209-21295231 TTTCCCACAAATTCAAACAAAGG - Intergenic
1187648814 X:21376678-21376700 TTTTAGACAAATTCAAAGAACGG - Intronic
1189361187 X:40353404-40353426 TTTCAACAAATTTCAAAAAATGG + Intergenic
1189857213 X:45235503-45235525 GTTCTACCAAATTCCAAGAAGGG + Intergenic
1191170565 X:57443050-57443072 ATTCACCAAAATTGAAATAAAGG - Intronic
1194020111 X:88678530-88678552 TTTCACCCACATTCAAGTATAGG - Intergenic
1194709781 X:97221427-97221449 TTTTACCCAAATTCAGAATAAGG - Intronic
1195158764 X:102150845-102150867 GTTCGCCCAAATTCAGGGAAAGG - Intergenic
1196316870 X:114237222-114237244 TTTGACCCCAATTCTAAAAAAGG - Intergenic
1196498831 X:116353136-116353158 CTTCACCCACAATCAAAGAAAGG - Intergenic
1196770519 X:119289040-119289062 TTTCACCCTCACTCAAAGGAAGG + Intergenic
1198717943 X:139582019-139582041 TTTCACACAAGTTAAAACAATGG + Intronic
1201547239 Y:15178977-15178999 CTTAATCCAAACTCAAAGAAGGG - Intergenic