ID: 1096952948

View in Genome Browser
Species Human (GRCh38)
Location 12:55494216-55494238
Sequence AATTACCTATAGCAATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096952946_1096952948 15 Left 1096952946 12:55494178-55494200 CCAAGAAAATATTAGATATTTAT 0: 1
1: 0
2: 2
3: 96
4: 1005
Right 1096952948 12:55494216-55494238 AATTACCTATAGCAATAGGAAGG 0: 1
1: 0
2: 2
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096952948 Original CRISPR AATTACCTATAGCAATAGGA AGG Intergenic
904876359 1:33657568-33657590 TATTACCTGAAGCAATAGAAGGG - Intronic
908334740 1:63110335-63110357 AATTGCAAATAGAAATAGGAAGG - Intergenic
908635109 1:66154864-66154886 AATTTCCTCAAGTAATAGGATGG + Intronic
908993906 1:70128822-70128844 GATTTCCTTTTGCAATAGGATGG - Intronic
909535381 1:76730026-76730048 AATTACCTATAGCTATTAAATGG - Intergenic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
913349358 1:117841202-117841224 ATTTACCTATAGTGACAGGATGG - Intergenic
913430280 1:118782994-118783016 AATTACCTATAACATTAACATGG + Intergenic
920129306 1:203719346-203719368 AATTACCTATTGAATTAAGAGGG - Intronic
920573044 1:207032530-207032552 CTTATCCTATAGCAATAGGAAGG - Intronic
1064872127 10:19949464-19949486 AACTACTAATAGGAATAGGAGGG + Intronic
1068168767 10:53365776-53365798 AATTTTCTATAGCAATAATAAGG + Intergenic
1068852055 10:61753947-61753969 AATTACATATAAAAATAGCATGG + Intronic
1072119103 10:92390626-92390648 AATCACCAATATCAATAAGATGG + Intergenic
1072570366 10:96653041-96653063 AAATATTTATAGCAATTGGATGG + Intronic
1079529004 11:21426613-21426635 ACCTACCTAATGCAATAGGAAGG - Intronic
1085925438 11:81014036-81014058 AAACACTTATAGCAATAAGAGGG + Intergenic
1086581768 11:88408214-88408236 AATTGGCTACAGCAATAGGGTGG - Intergenic
1086998248 11:93384413-93384435 AATTGCCTAAAGCAAAAGTAAGG - Intronic
1089661567 11:119989451-119989473 AATTACCTGTAGAAATAGGATGG + Intergenic
1090230564 11:125100092-125100114 GATTAACTATGGCAAGAGGAAGG - Intronic
1090900271 11:131024783-131024805 AATTACCTATAGAAATAATAAGG + Intergenic
1093764669 12:22949547-22949569 ATTTACCTATAGACACAGGAAGG - Intergenic
1096952948 12:55494216-55494238 AATTACCTATAGCAATAGGAAGG + Intergenic
1097163638 12:57068939-57068961 CATTACTTCTAGCAATAGAAAGG + Intronic
1099300236 12:80884131-80884153 AAGTACCTATAGCCATTAGACGG - Intronic
1106713170 13:32360118-32360140 AATGACCTAAAGTAAAAGGAGGG + Intronic
1108133486 13:47329716-47329738 AATTACCCCTAGGTATAGGATGG - Intergenic
1108781205 13:53837076-53837098 AATAACCTCTAGCAATGTGAAGG - Intergenic
1109610383 13:64757586-64757608 AATTGCTGATAGTAATAGGATGG + Intergenic
1112704911 13:102056874-102056896 AATTACCTATTGCAATAAAAGGG - Intronic
1115019495 14:28659049-28659071 AATAACCAATAGCAATAGAATGG + Intergenic
1117951954 14:61091620-61091642 AAATAGCTATAGCTATAGTAAGG - Intergenic
1124039177 15:26084338-26084360 AATTACCTATCAAAATAGGAAGG + Intergenic
1126733691 15:51710520-51710542 AATTACCTATAAAAATGGTATGG - Intronic
1131727248 15:95239914-95239936 AATCACCTAAAGCAACAAGAGGG + Intergenic
1131824151 15:96303953-96303975 AATTACCTACTGCAAGAGGTGGG - Intergenic
1134325087 16:13200198-13200220 AAATACTTGTAGCAAAAGGATGG - Intronic
1139086287 16:63590463-63590485 AATAACATATTGCAATAGGGTGG + Intergenic
1140838523 16:78817852-78817874 AATGACCTATGACAATAAGAAGG - Intronic
1153132235 18:1868010-1868032 AATTATATATAACAATTGGAGGG + Intergenic
1155609933 18:27655100-27655122 AGTTACATATTGCAATAGCATGG - Intergenic
1155697936 18:28706049-28706071 AGTTAACTTTAGCAAGAGGAGGG + Intergenic
1157649802 18:49316838-49316860 AAATGCCTATAGCTAAAGGAAGG - Intronic
1159531635 18:69662865-69662887 AATGACTTTAAGCAATAGGATGG + Intronic
1165328876 19:35130342-35130364 TATTATCTATAACAATATGAAGG - Intronic
1165521181 19:36315347-36315369 TATCACCTATAGCCACAGGATGG + Intergenic
1165622886 19:37263243-37263265 TATCACCTATAGCCACAGGATGG - Intergenic
1165634578 19:37329874-37329896 TATCACCTATAGCCACAGGATGG - Intronic
925778490 2:7357575-7357597 AGTTACCTGAAGCACTAGGAAGG - Intergenic
925802994 2:7619958-7619980 TATGACCCATAGCAATTGGAAGG - Intergenic
927271801 2:21218475-21218497 AAATACCTCTAGCAATATTAAGG - Intergenic
934855624 2:97727626-97727648 AATCAGCTACATCAATAGGAAGG - Intronic
939668382 2:144978626-144978648 TATTACTTAAATCAATAGGAAGG - Intergenic
940199481 2:151134619-151134641 AATTACCAATATCAAAATGAGGG + Intergenic
942060329 2:172223455-172223477 GAGTAGCTATAGCAAAAGGAGGG - Intergenic
945145889 2:206737472-206737494 AATTACCCATTGCATTATGATGG + Intergenic
1169667325 20:8052132-8052154 AATTAGCTATAGAAATAGGTTGG - Intergenic
1169742770 20:8913324-8913346 AATTAGCTATTGAAAGAGGATGG - Intronic
1170838138 20:19902474-19902496 AGTTTCCTATAGCAAAAGGTGGG + Intronic
1172342657 20:34170592-34170614 AATTACCTAGACCAATAGTAAGG + Intergenic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
1177080241 21:16630712-16630734 CATTACCAAGAGCAGTAGGAGGG + Intergenic
1177224559 21:18237319-18237341 AATTACGTATAGCGAAAGTAAGG + Intronic
1177346749 21:19883072-19883094 AATTACCTTGTGAAATAGGAAGG + Intergenic
1177667819 21:24184517-24184539 AATTACCAATAACTAAAGGAGGG + Intergenic
1177894932 21:26846203-26846225 AATTCCCTAGAGCATAAGGAGGG + Intergenic
949974921 3:9447669-9447691 AATATCCTGTAGCAATAGTAGGG - Exonic
950458581 3:13107365-13107387 AATTAACTATAGCAACCGCAGGG - Intergenic
950937113 3:16850427-16850449 AATTACCTACAGCAACAGGAAGG - Intronic
950947350 3:16962799-16962821 AATTATCTTTAGGAATAAGAAGG - Intronic
951375835 3:21915700-21915722 AATTGCACATAGCATTAGGAAGG + Intronic
951614505 3:24526212-24526234 AACCACCTAAAGCAAAAGGAAGG + Intergenic
951942915 3:28101360-28101382 AATGGCCTATAGCATTTGGAAGG + Intergenic
956633378 3:71338359-71338381 AATAACCTAAAGAAAAAGGATGG + Intronic
957890907 3:86356268-86356290 AATAACCCACAGCAATAGGCAGG - Intergenic
959151607 3:102614851-102614873 AAATAACTATAGCAATATGCAGG - Intergenic
960373565 3:116870726-116870748 TATGACCTAAAGCAACAGGAGGG - Intronic
964973794 3:162594960-162594982 ATTTAGATACAGCAATAGGAGGG + Intergenic
968397919 4:260755-260777 GATTACCTAGAGAAACAGGAGGG + Intergenic
969033887 4:4235457-4235479 AATTAACTGTAGCAATAACAAGG - Intergenic
970299903 4:14670176-14670198 GATTATCTGTAGAAATAGGATGG - Intergenic
974396831 4:61347326-61347348 AAGTTCCTAGAGCTATAGGAAGG + Intronic
974712462 4:65617561-65617583 AATTACTTCTAGGAAAAGGAGGG - Intronic
975146833 4:70977377-70977399 AATGAGCAATAGCAATATGATGG + Intronic
981125882 4:141105801-141105823 AATTACCAATAACAATAGTCTGG - Intronic
981897903 4:149825662-149825684 AAGGAGCTATAGGAATAGGAAGG - Intergenic
982251448 4:153411287-153411309 AGATACCTATAGGAATAGGATGG - Intronic
982470330 4:155782027-155782049 CATTGACTATAGCAATAGCATGG - Intronic
984057800 4:174950522-174950544 AGTTACATATAGCAATAGTTAGG - Intronic
984074926 4:175164498-175164520 AATAACCTAAAGCAGAAGGAAGG - Intergenic
984282808 4:177692107-177692129 AAACACGTATAGAAATAGGATGG + Intergenic
985883869 5:2661082-2661104 AATTGCCTATTTCAATAAGATGG + Intergenic
986946444 5:13027787-13027809 AACTACCTTTAGCAGTATGATGG + Intergenic
987429521 5:17815392-17815414 AATTACATACAACATTAGGATGG + Intergenic
987660092 5:20861289-20861311 AATTAACTATAGAAACATGATGG - Intergenic
987793878 5:22604056-22604078 AATTCACTATAGCAATGAGATGG + Intronic
988358260 5:30203707-30203729 AATTACTTACAGAATTAGGAAGG + Intergenic
988763554 5:34344360-34344382 AATTAACTATAGAAACATGATGG + Intergenic
995831342 5:116359144-116359166 AAACACCTATAGAAATAGGGAGG - Intronic
997958269 5:138297537-138297559 AATTACCTATGGCTAGAGGGAGG - Intronic
1002393090 5:178931070-178931092 AATTAGGTAGAGAAATAGGAAGG - Intronic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1006226550 6:32542694-32542716 AATAACCTAAAGCAAGAAGAAGG - Intergenic
1007658245 6:43465904-43465926 AATCACCTAGATCAATAGCATGG - Intergenic
1008022061 6:46589970-46589992 AATTACCACTAGCAACAGGGAGG + Intronic
1011206830 6:84908061-84908083 AATTACCATAAACAATAGGAAGG + Intergenic
1011231232 6:85164556-85164578 AATTATCTATAGCAGAATGAAGG - Intergenic
1013508073 6:110819037-110819059 AAGAAGCTATTGCAATAGGACGG + Intronic
1015380863 6:132566664-132566686 AATAATCTATAGCGATAGAAAGG + Intergenic
1023790979 7:43753446-43753468 AATTACCCACAGCTTTAGGATGG - Intergenic
1026305122 7:69134002-69134024 AATTACCTTCAGCAATAACAGGG + Intergenic
1027722306 7:81759859-81759881 ACTTAGCTATAGGAATAGTAGGG - Intronic
1028131933 7:87185752-87185774 AATTACCTGTAGTCAGAGGAGGG + Intronic
1028947203 7:96593543-96593565 CATTTACTATAGCAAGAGGAGGG - Intronic
1031307738 7:120153944-120153966 ATTTATCTATATCAATAAGATGG - Intergenic
1032918233 7:136515462-136515484 AACTCTCTCTAGCAATAGGATGG - Intergenic
1034816217 7:154174040-154174062 AATACCCTATAGCCAAAGGATGG - Intronic
1034917032 7:155048711-155048733 AATTACCTTTAGCCAAATGAGGG - Intergenic
1037226866 8:16602904-16602926 AATTACTTATATGAATGGGAGGG - Intergenic
1038405530 8:27319700-27319722 TATGAGCTATAGCAATAGCAAGG + Intronic
1038537862 8:28367307-28367329 TATTACTTAGAGTAATAGGAAGG - Intronic
1041548298 8:59071624-59071646 AATGCCCTATAGTATTAGGATGG + Intronic
1041633715 8:60118376-60118398 AAGTACCTACTGCAAAAGGAAGG + Intergenic
1043265462 8:78262135-78262157 AATTAGATATAGAAATAGAATGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046321433 8:112582126-112582148 AATCACTTATATCAATGGGATGG - Intronic
1046814104 8:118565131-118565153 AATTTCCTGTAGGAATATGAGGG - Intronic
1047889043 8:129287133-129287155 AATTGCCTATAGCAATTTCAGGG + Intergenic
1049946421 9:600993-601015 AATTAACTAAAGCAGAAGGAGGG + Intronic
1053436661 9:38080054-38080076 TAATACCTACAGCAATAGAAAGG + Intergenic
1061289874 9:129644644-129644666 CATTACCTAAAGGAGTAGGAAGG + Intergenic
1187757099 X:22539964-22539986 AATTCCTTATAGCTGTAGGATGG - Intergenic
1193616655 X:83696455-83696477 AAATACCTATATCAAAAGGAAGG - Intergenic
1194500884 X:94679415-94679437 AATTACCAATAGCAATATCTAGG - Intergenic
1195850696 X:109278929-109278951 AAGTACTTATAGTATTAGGAAGG - Intergenic
1196905827 X:120433208-120433230 CATTGCCTCTAGCAATATGAAGG + Intronic
1197194449 X:123683936-123683958 TATTACATAGAGCAATATGAGGG + Intronic
1198512891 X:137372037-137372059 TATTACCTATTGCAACAAGAAGG + Intergenic
1200308808 X:155056697-155056719 ACTTACCCACAGCAATGGGATGG + Exonic