ID: 1096956637

View in Genome Browser
Species Human (GRCh38)
Location 12:55532868-55532890
Sequence TCTTCAAGACAGAAGATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956637_1096956641 21 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956641 12:55532912-55532934 CTCACATAAACTGAAGGTAAAGG 0: 4
1: 327
2: 470
3: 415
4: 820
1096956637_1096956642 22 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1096956637_1096956640 15 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956640 12:55532906-55532928 TAAGGGCTCACATAAACTGAAGG No data
1096956637_1096956639 -2 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956639 12:55532889-55532911 GAGACTCATCTAATACATAAGGG No data
1096956637_1096956638 -3 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956638 12:55532888-55532910 AGAGACTCATCTAATACATAAGG No data
1096956637_1096956643 23 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956643 12:55532914-55532936 CACATAAACTGAAGGTAAAGGGG 0: 5
1: 279
2: 453
3: 421
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956637 Original CRISPR TCTTCAAGACAGAAGATGCT TGG (reversed) Intergenic
No off target data available for this crispr