ID: 1096956642

View in Genome Browser
Species Human (GRCh38)
Location 12:55532913-55532935
Sequence TCACATAAACTGAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956636_1096956642 29 Left 1096956636 12:55532861-55532883 CCACTAACCAAGCATCTTCTGTC No data
Right 1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1096956637_1096956642 22 Left 1096956637 12:55532868-55532890 CCAAGCATCTTCTGTCTTGAAGA No data
Right 1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956642 Original CRISPR TCACATAAACTGAAGGTAAA GGG Intergenic
Too many off-targets to display for this crispr