ID: 1096956811

View in Genome Browser
Species Human (GRCh38)
Location 12:55534596-55534618
Sequence ACTGGGTTGACAGCTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956811_1096956816 8 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956816 12:55534627-55534649 TCCACCTGGAAACAGAATTGAGG 0: 2
1: 8
2: 44
3: 62
4: 272
1096956811_1096956819 17 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956819 12:55534636-55534658 AAACAGAATTGAGGCTGTTGTGG No data
1096956811_1096956821 19 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956821 12:55534638-55534660 ACAGAATTGAGGCTGTTGTGGGG No data
1096956811_1096956813 -6 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956813 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
1096956811_1096956820 18 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956820 12:55534637-55534659 AACAGAATTGAGGCTGTTGTGGG No data
1096956811_1096956823 28 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956823 12:55534647-55534669 AGGCTGTTGTGGGGGCATGATGG No data
1096956811_1096956822 20 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956822 12:55534639-55534661 CAGAATTGAGGCTGTTGTGGGGG No data
1096956811_1096956824 29 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956811 Original CRISPR ACTGGGTTGACAGCTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr