ID: 1096956812

View in Genome Browser
Species Human (GRCh38)
Location 12:55534613-55534635
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956812_1096956820 1 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956820 12:55534637-55534659 AACAGAATTGAGGCTGTTGTGGG No data
1096956812_1096956819 0 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956819 12:55534636-55534658 AAACAGAATTGAGGCTGTTGTGG No data
1096956812_1096956816 -9 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956816 12:55534627-55534649 TCCACCTGGAAACAGAATTGAGG 0: 2
1: 8
2: 44
3: 62
4: 272
1096956812_1096956821 2 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956821 12:55534638-55534660 ACAGAATTGAGGCTGTTGTGGGG No data
1096956812_1096956822 3 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956822 12:55534639-55534661 CAGAATTGAGGCTGTTGTGGGGG No data
1096956812_1096956823 11 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956823 12:55534647-55534669 AGGCTGTTGTGGGGGCATGATGG No data
1096956812_1096956825 23 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956812_1096956824 12 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956812 Original CRISPR CCAGGTGGAGGCGTGTGACT GGG (reversed) Intergenic
No off target data available for this crispr