ID: 1096956815

View in Genome Browser
Species Human (GRCh38)
Location 12:55534625-55534647
Sequence TCAATTCTGTTTCCAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956815_1096956822 -9 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956822 12:55534639-55534661 CAGAATTGAGGCTGTTGTGGGGG No data
1096956815_1096956821 -10 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956821 12:55534638-55534660 ACAGAATTGAGGCTGTTGTGGGG No data
1096956815_1096956825 11 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956815_1096956824 0 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956815_1096956823 -1 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956823 12:55534647-55534669 AGGCTGTTGTGGGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956815 Original CRISPR TCAATTCTGTTTCCAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr