ID: 1096956817

View in Genome Browser
Species Human (GRCh38)
Location 12:55534628-55534650
Sequence GCCTCAATTCTGTTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956817_1096956825 8 Left 1096956817 12:55534628-55534650 CCACCTGGAAACAGAATTGAGGC No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956817_1096956824 -3 Left 1096956817 12:55534628-55534650 CCACCTGGAAACAGAATTGAGGC No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956817_1096956823 -4 Left 1096956817 12:55534628-55534650 CCACCTGGAAACAGAATTGAGGC No data
Right 1096956823 12:55534647-55534669 AGGCTGTTGTGGGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956817 Original CRISPR GCCTCAATTCTGTTTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr