ID: 1096956824

View in Genome Browser
Species Human (GRCh38)
Location 12:55534648-55534670
Sequence GGCTGTTGTGGGGGCATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956817_1096956824 -3 Left 1096956817 12:55534628-55534650 CCACCTGGAAACAGAATTGAGGC No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956814_1096956824 11 Left 1096956814 12:55534614-55534636 CCAGTCACACGCCTCCACCTGGA No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956811_1096956824 29 Left 1096956811 12:55534596-55534618 CCAGGGCAAGCTGTCAACCCAGT No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956812_1096956824 12 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956818_1096956824 -6 Left 1096956818 12:55534631-55534653 CCTGGAAACAGAATTGAGGCTGT No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956815_1096956824 0 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data
1096956810_1096956824 30 Left 1096956810 12:55534595-55534617 CCCAGGGCAAGCTGTCAACCCAG No data
Right 1096956824 12:55534648-55534670 GGCTGTTGTGGGGGCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956824 Original CRISPR GGCTGTTGTGGGGGCATGAT GGG Intergenic
No off target data available for this crispr