ID: 1096956825

View in Genome Browser
Species Human (GRCh38)
Location 12:55534659-55534681
Sequence GGGCATGATGGGAGTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096956818_1096956825 5 Left 1096956818 12:55534631-55534653 CCTGGAAACAGAATTGAGGCTGT No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956812_1096956825 23 Left 1096956812 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956814_1096956825 22 Left 1096956814 12:55534614-55534636 CCAGTCACACGCCTCCACCTGGA No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956815_1096956825 11 Left 1096956815 12:55534625-55534647 CCTCCACCTGGAAACAGAATTGA No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data
1096956817_1096956825 8 Left 1096956817 12:55534628-55534650 CCACCTGGAAACAGAATTGAGGC No data
Right 1096956825 12:55534659-55534681 GGGCATGATGGGAGTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096956825 Original CRISPR GGGCATGATGGGAGTGAGTC TGG Intergenic
No off target data available for this crispr