ID: 1096960340

View in Genome Browser
Species Human (GRCh38)
Location 12:55570708-55570730
Sequence CAAAATACTGATAGCAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 4, 2: 25, 3: 78, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096960340_1096960344 4 Left 1096960340 12:55570708-55570730 CCCATATTGCTATCAGTATTTTG 0: 1
1: 4
2: 25
3: 78
4: 369
Right 1096960344 12:55570735-55570757 AAGCCATTCAACAAGACTCTAGG 0: 15
1: 1500
2: 1902
3: 1418
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096960340 Original CRISPR CAAAATACTGATAGCAATAT GGG (reversed) Intergenic