ID: 1096960340

View in Genome Browser
Species Human (GRCh38)
Location 12:55570708-55570730
Sequence CAAAATACTGATAGCAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 4, 2: 25, 3: 78, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096960340_1096960344 4 Left 1096960340 12:55570708-55570730 CCCATATTGCTATCAGTATTTTG 0: 1
1: 4
2: 25
3: 78
4: 369
Right 1096960344 12:55570735-55570757 AAGCCATTCAACAAGACTCTAGG 0: 15
1: 1500
2: 1902
3: 1418
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096960340 Original CRISPR CAAAATACTGATAGCAATAT GGG (reversed) Intergenic
900007440 1:71781-71803 CAAAATATTAATAGGAAAATGGG + Intergenic
904796368 1:33059285-33059307 CAAAACCTTGATAGGAATATGGG + Intronic
905065297 1:35175858-35175880 CAGAATACTGATGGGAATGTTGG - Intergenic
905414747 1:37796009-37796031 CAAAAAACTAAGAGCAACATAGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907940948 1:59086575-59086597 GAAAATACTGAGACCAATAAAGG + Intergenic
908076930 1:60530089-60530111 CAGAAGATTGATAGCTATATGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909225000 1:73008238-73008260 CAATATACTGCTATCAACATAGG - Intergenic
909241986 1:73224742-73224764 CAAAATGCAGATACCAATAGCGG - Intergenic
909412099 1:75366557-75366579 CCAAATCTTGACAGCAATATGGG - Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
911538317 1:99127239-99127261 CAAAATAATAAGAGCAGTATAGG - Intergenic
911868533 1:103060483-103060505 CAAAATAATAATAGCAATAATGG + Intronic
911877940 1:103193145-103193167 AAAAATACAGATAGCCATTTAGG - Intergenic
912040351 1:105382821-105382843 AAAAATATTAACAGCAATATAGG - Intergenic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
916326546 1:163566572-163566594 TAAAATACTAATAGGAAAATTGG - Intergenic
917335892 1:173924070-173924092 CAAACCACTGATGGCAATGTTGG - Intergenic
917484584 1:175444127-175444149 CAAAATACTTATAACCAGATAGG + Intronic
917990746 1:180375996-180376018 CAAAAACCTGATAGAAAAATGGG + Intronic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
918938976 1:190964985-190965007 CAAAATTCTTATAGCTCTATGGG - Intergenic
918960563 1:191271233-191271255 CAAAAAACTGATAACAATCCAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920904979 1:210155051-210155073 CAAAATACAGAAAGCAAAAATGG - Intronic
921650488 1:217672607-217672629 CAAAAGACTGATATCTATTTAGG - Intronic
922017672 1:221667882-221667904 CAAATTACTGATAGCCTTGTTGG + Intergenic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
924280122 1:242428664-242428686 CAAAGTACTGAAAAAAATATAGG - Intronic
924866147 1:247983497-247983519 TAAAATACTTATAGCTATTTTGG + Intronic
1062808632 10:444743-444765 CAAAATACTGAAACCAAAATAGG - Intronic
1062958634 10:1556900-1556922 AAAAATAGTGATAGGAATAGAGG - Intronic
1063293527 10:4777101-4777123 CAACATACTCATAGCATTGTGGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067366848 10:45639385-45639407 CCAAATACTGGTAAGAATATGGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068459946 10:57315346-57315368 CATACTACTGATAACAATAAAGG - Intergenic
1071407395 10:85351342-85351364 CAATATCCAGATACCAATATTGG + Intergenic
1071925341 10:90400995-90401017 GAAAATATTAATAGAAATATTGG - Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1075976736 10:126702632-126702654 CAAAATACTCAAAGCCACATAGG + Intergenic
1076457702 10:130612805-130612827 CCAAAAACTGAGAGAAATATAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078985960 11:16597948-16597970 TAAAATAGAAATAGCAATATAGG - Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079740810 11:24057904-24057926 CAAAATTCAGGTAGCAATGTGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1081960800 11:47135445-47135467 CAGAACACTGATAGGCATATGGG - Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083313709 11:61800935-61800957 TATTATACTGATAGGAATATAGG + Exonic
1086767806 11:90720221-90720243 CAAAATACTGAAGGCCATCTAGG - Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087385978 11:97469350-97469372 CAAAACAGTGATGGCAATTTAGG - Intergenic
1087392399 11:97554258-97554280 CAAAATATTGTTAGTATTATTGG - Intergenic
1087741619 11:101894123-101894145 CAGAATACTGATAGAACTTTTGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088292885 11:108260535-108260557 CAAAATAGTCATACCAATTTAGG + Intronic
1088323591 11:108579144-108579166 CAAAACAATCAAAGCAATATAGG - Intronic
1088826460 11:113498672-113498694 CCAAAACCTGATAGAAATATTGG + Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093611486 12:21164713-21164735 CAAAATACTTAAAACAAAATAGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096199589 12:49672265-49672287 CAAGATAATGATACCAAAATTGG - Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1097857544 12:64481015-64481037 CAAAAAACTGTTAACAATAGTGG - Intronic
1098047338 12:66413948-66413970 CAAAATAGTGAAAGCCACATAGG + Intronic
1099334877 12:81342774-81342796 CAAAATTCTGACAGCAAAAATGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104338047 12:127919021-127919043 CACAATACTGATAGGCAGATTGG - Intergenic
1105228336 13:18460262-18460284 CAAAATAATTACAGCCATATAGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106073601 13:26437682-26437704 AAAAATAATAATAGCAATAAAGG + Intergenic
1107225874 13:38046286-38046308 CAAAATATGGATAGGAATAAAGG + Intergenic
1107410694 13:40155936-40155958 TAAAATACTGAAAGTAATTTGGG - Intergenic
1108411650 13:50154971-50154993 TAAAAGACTGACAGCAATGTAGG - Intronic
1108878008 13:55072404-55072426 CACACTACTGATAGCAACGTAGG + Intergenic
1108909765 13:55532539-55532561 CAAAATACTGATATCACCATGGG - Intergenic
1109348269 13:61144063-61144085 CAAGATAATGTAAGCAATATTGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109419687 13:62095407-62095429 TAAAAAACTGATAAGAATATAGG + Intergenic
1109454293 13:62564060-62564082 AAAAGTACTGACACCAATATTGG - Intergenic
1109859883 13:68183552-68183574 AAAATAACTGATAGCAAAATGGG - Intergenic
1110117839 13:71842244-71842266 AATAATACTGATAGCAGAATTGG + Intronic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112790532 13:102997583-102997605 CAAACTACTTACAGCAATTTTGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114946445 14:27687470-27687492 AAAAACACTGATATCAAAATTGG + Intergenic
1115345028 14:32333697-32333719 AAAAATACTAATTGCCATATTGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116506607 14:45690328-45690350 CAAAATAATAAGAGCCATATAGG + Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116937091 14:50751870-50751892 CAAAAATTTGATAGCAAAATGGG - Intronic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117311516 14:54528882-54528904 CTAAATACTGAGAGTAAAATTGG + Intronic
1118640644 14:67789143-67789165 CAAAATAGACATAGCAATTTGGG - Intronic
1118881804 14:69833926-69833948 TATAATACTGATAGCAAATTTGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124781792 15:32642809-32642831 CAACATAATAATAGCAATATAGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126546776 15:49882433-49882455 AAAAATACTCATAGCAGCATTGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1129013620 15:72445966-72445988 CAAAAGACTGATTTCAATAGTGG + Intergenic
1129165916 15:73777399-73777421 CAAAATGGAGATAGCAATAGGGG - Intergenic
1129429844 15:75491702-75491724 CAGAAAACTGGTAGAAATATGGG + Intronic
1130409536 15:83633152-83633174 CAAAATACTCAAGGCATTATTGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1132296610 15:100739555-100739577 AACAATACTGTTAGCAATGTTGG - Intergenic
1132446110 15:101920344-101920366 CAAAATATTAATAGGAAAATGGG - Intergenic
1134741172 16:16548157-16548179 ACTAATACAGATAGCAATATTGG - Intergenic
1134837463 16:17373944-17373966 CAAACAACTGATTGCAAAATTGG + Intronic
1134926328 16:18163971-18163993 ACTAATACAGATAGCAATATTGG + Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137948848 16:52762587-52762609 CCAAATACTGATATCACTAAAGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139118639 16:63987982-63988004 CAAAATACTAATAACATTCTAGG - Intergenic
1139398285 16:66658572-66658594 CAAAATCCTGATACCCACATTGG + Intronic
1139819144 16:69706352-69706374 CAAAATACTGATCTGAAGATGGG + Intergenic
1142824585 17:2500763-2500785 CAAAATTATGATAACTATATGGG - Intronic
1142942853 17:3397408-3397430 TAAAATATTGATATTAATATTGG - Exonic
1143666382 17:8364171-8364193 AAAAATAATGATAAAAATATTGG - Intergenic
1146938758 17:36828856-36828878 AAAAATAGTGACTGCAATATGGG + Intergenic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1148356839 17:46980959-46980981 TAAAATAATGATAACAATGTTGG - Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149154958 17:53617497-53617519 CAAAATACTAACATAAATATAGG - Intergenic
1149647526 17:58250899-58250921 TAAACTACTGATAGCAGAATGGG + Intronic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1155956961 18:31962432-31962454 CAAAAAACTGATACCATTGTTGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156307900 18:35896292-35896314 TAATATGCTGCTAGCAATATGGG + Intergenic
1159280263 18:66275797-66275819 TAAAATATTGATATAAATATTGG - Intergenic
1159625071 18:70683355-70683377 CAAAGTACAGATAACGATATGGG + Intergenic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1160459597 18:79028085-79028107 AAAAATACTGAAAGAAATAATGG + Intergenic
1160639198 19:113369-113391 CAAAATATTAATAGGAAAATGGG + Intergenic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1168091377 19:54087344-54087366 CAAAATAATGATTGCAATACTGG + Intergenic
1168514398 19:56999068-56999090 CAAAATACTTATGTAAATATTGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926998033 2:18759407-18759429 CAAAATTATGATAACTATATTGG - Intergenic
928794601 2:35001552-35001574 CAAAATATAGAAAGCAAGATTGG + Intergenic
928941113 2:36728243-36728265 TAAAATAATGATAAAAATATAGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930471081 2:51814463-51814485 CAACATACTCAAAGAAATATAGG + Intergenic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931648005 2:64442819-64442841 AATAATAATGACAGCAATATTGG - Intergenic
932214831 2:69959889-69959911 CAAAATAATGAGAGCAATTCTGG + Intergenic
932272392 2:70422217-70422239 CAAACTATTGGTAGGAATATTGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933261234 2:80134055-80134077 TAAAATAATAATAGCAATAATGG - Intronic
933385628 2:81607201-81607223 CTAAATACTGAAGACAATATGGG + Intergenic
933464277 2:82632179-82632201 TTCAATACTGAGAGCAATATAGG + Intergenic
935107379 2:100057538-100057560 AATAACACTGATAGTAATATTGG - Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935378972 2:102431277-102431299 AAATCCACTGATAGCAATATTGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937015416 2:118601052-118601074 CACACTGCTGATAGCAATACTGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938749547 2:134315410-134315432 AAAAATAGTGATAGGAATAATGG + Intronic
938916195 2:135942711-135942733 CAAAAAACTTATAGCAAGATAGG + Intronic
939318993 2:140591118-140591140 AAATATACTGAAATCAATATTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942905764 2:181179053-181179075 TAAAATTCTGATAGCAATGCTGG - Intergenic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
943334647 2:186599221-186599243 CAAGAAACTGATTGAAATATAGG - Intronic
943359704 2:186902432-186902454 CAAAATAATGATAGCATTTTAGG - Intergenic
943752213 2:191521173-191521195 CAAAATACTAGTTGCAATGTTGG + Intergenic
943790722 2:191929772-191929794 CAAATTACAGAATGCAATATTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945711098 2:213295816-213295838 CAAAAGACAGATAGCAATGTAGG + Intronic
945940539 2:215945019-215945041 CAAAAAACTGCTGGCAAGATAGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947569311 2:231219235-231219257 AAAAATACTGGTAGCTATAAGGG - Intronic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948148420 2:235726061-235726083 CAAATTAATTATAACAATATGGG - Intronic
1169712326 20:8579064-8579086 CAGAAGACTGATTGCATTATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170956938 20:20989929-20989951 TAAAATACATATGGCAATATGGG + Intergenic
1173063127 20:39681134-39681156 CAAAATACTTATTGCTATACTGG - Intergenic
1174626450 20:51918750-51918772 CAAAATACTGTTTGCATTTTGGG - Intergenic
1174740669 20:53010805-53010827 AAAAATATTAATAGCAATTTGGG - Intronic
1174778662 20:53368653-53368675 CCATAAACTGATAGCAATATAGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176772316 21:13088442-13088464 CAAAATAATTACAGCCATATAGG - Intergenic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177485862 21:21755425-21755447 CAAAATACTCAGAGCAGTAGAGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177946790 21:27480396-27480418 CTAAATTTTGATAGAAATATGGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178601672 21:34000031-34000053 CAAAATATGGGTAGCAATTTTGG + Intergenic
1178821180 21:35976779-35976801 CAAGATACTGATATCAACAAAGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
1183895385 22:40964345-40964367 CAAAATACTGCTAACAAAATTGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951635429 3:24769654-24769676 CAAAATAAATAAAGCAATATTGG + Intergenic
952103421 3:30041460-30041482 CAAAATAATAAGAGCCATATAGG + Intergenic
953100150 3:39816738-39816760 CATAATAATTATAGAAATATAGG + Intronic
953382596 3:42485055-42485077 TAAAATACTGGTATAAATATAGG + Intergenic
953997105 3:47528318-47528340 CAAAATACTCAGAGAAATAATGG + Intergenic
954480844 3:50799174-50799196 CCAAATACTCAAAGCAATCTTGG - Intronic
956092306 3:65680818-65680840 CATAATAATGATAGCAATTATGG + Intronic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
957990643 3:87622817-87622839 CAAATTAGGGATAGCAATATAGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960098500 3:113712523-113712545 CAAATTACTGATATCAGTAATGG - Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962400475 3:135055014-135055036 CAAAATATTAATAGAATTATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963424506 3:145109262-145109284 CAAAATACTGATAACACCAAAGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964828999 3:160862188-160862210 CAAAATACTAAAAGTAATTTTGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967503355 3:190224995-190225017 CAAAGTAGTCATAGCAAAATTGG + Intergenic
968403935 4:323037-323059 CAAAATACTAATGACAATAATGG + Intergenic
968895552 4:3400154-3400176 CATATTCCTGATACCAATATTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969949087 4:10815343-10815365 CAAAATATTGTTAACAATTTAGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971521098 4:27551338-27551360 CAAAATACAGACACAAATATAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972103504 4:35452069-35452091 CAAAATAGTGTTGGCAATTTTGG - Intergenic
972192571 4:36612709-36612731 GGAAAGACTGATAGCAGTATGGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973683953 4:53350423-53350445 CAAAATAGTTCTAGGAATATAGG - Intronic
974295308 4:59990994-59991016 CAAAATACTTTTAGCTATAATGG - Intergenic
974376383 4:61082139-61082161 CAAAAAATTGATGGAAATATAGG - Intergenic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974741224 4:66010688-66010710 CATCATACTGATAGCAAAACTGG - Intergenic
975099764 4:70499457-70499479 CATAATACTGATATTAAAATTGG + Intergenic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
976819638 4:89190892-89190914 TATAAGACTGAGAGCAATATTGG - Intergenic
977354512 4:95927949-95927971 TAAAATACTTATTGCAATAAAGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977379534 4:96254330-96254352 TAAAATACTGAAAGAAAAATTGG + Intergenic
977639320 4:99338157-99338179 AAAAATTGTGATATCAATATTGG - Intronic
977866461 4:102034145-102034167 CAATATACTGATACCATTTTTGG - Intronic
978060718 4:104334393-104334415 CAAAATAATAAGAGCCATATAGG + Intergenic
978800117 4:112747882-112747904 CAAAATAGTCCTAGCAAAATGGG + Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980294144 4:130888531-130888553 CAAAATACTTCTACCAATAAGGG + Intergenic
980314692 4:131182471-131182493 TAAAATATAGAAAGCAATATGGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980431253 4:132699495-132699517 CAAAAGACAGATAGATATATTGG + Intergenic
980534350 4:134096456-134096478 CAAAATATTCATAAAAATATTGG + Intergenic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981559018 4:146026751-146026773 CAAAATATTGAAAGGAATTTAGG + Intergenic
981577041 4:146216269-146216291 AAACATACTGATAACAATTTTGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
981987855 4:150879368-150879390 CAAAATAATGAGAGCCATCTAGG + Intronic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984033757 4:174639052-174639074 CAAAAGACAGCTAGTAATATTGG - Exonic
984466428 4:180105362-180105384 AAATAGAGTGATAGCAATATTGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985448585 4:190043116-190043138 GAAATTACTGATAGCAACAAAGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986811722 5:11366980-11367002 CAAAAGACTGATATCCACATAGG - Intronic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
989432180 5:41368677-41368699 CAAAATAATAAGAGCCATATAGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990644999 5:57834147-57834169 CATAACATTAATAGCAATATGGG + Intergenic
990677689 5:58206156-58206178 CTAAATATTTAAAGCAATATTGG - Intergenic
991144996 5:63290940-63290962 CAAAAATCTGATAGAAAAATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992471588 5:77061704-77061726 GAAATTACTGATAGCAACAAAGG + Exonic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993475759 5:88362130-88362152 CAAAAGAGTTATTGCAATATGGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994175825 5:96709911-96709933 CTATAAAATGATAGCAATATTGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994556193 5:101307702-101307724 AAAGATATAGATAGCAATATTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
994866683 5:105281493-105281515 CAAAACACTGACAGCAGTGTTGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995916478 5:117251596-117251618 CATAATACAAATAGAAATATAGG + Intergenic
997810804 5:136966439-136966461 CATAATATTGCTAGGAATATTGG + Intergenic
997810805 5:136966466-136966488 CAAAATATTGCTATGAATATTGG + Intergenic
998470420 5:142379485-142379507 TAACATACTGTTAGCAATTTAGG + Intergenic
999541304 5:152575397-152575419 CAAAAGACTGATAGCTATTATGG - Intergenic
999841586 5:155433291-155433313 CAAAATAGGGATAGCAATAATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002746549 6:61774-61796 CAAAATATTAATAGGAAAATGGG + Intergenic
1005197978 6:23311033-23311055 GAAAATCCTGACAGCAATACTGG + Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006948846 6:37804824-37804846 CAAAATTCTAAGAGGAATATTGG + Intergenic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010052607 6:71525404-71525426 CAAAACACTAACAGCAACATAGG + Intergenic
1010103586 6:72141069-72141091 CAAAATATTGTTGGAAATATTGG - Intronic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010226484 6:73494251-73494273 GAAAATACTGAGAATAATATTGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010684472 6:78837090-78837112 CAAAAGAATGAGATCAATATTGG + Intergenic
1011073017 6:83406311-83406333 CATCATCCTGATAGCAAAATTGG - Intronic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012756420 6:103237598-103237620 CAAAATAATAAAAGCTATATAGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012801153 6:103830486-103830508 CAAAATACTGTCAAGAATATGGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014486405 6:122004234-122004256 AAAAATAATGATGGCATTATTGG - Intergenic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016250976 6:142042511-142042533 CAAAATATTCTTAGCAATAATGG - Intergenic
1016600986 6:145860002-145860024 CAAAATGATGTTAGCAGTATAGG - Intergenic
1016865903 6:148765989-148766011 CAAAATAATAAAAGCCATATAGG - Intronic
1017338527 6:153290895-153290917 CTGAATTCTGATACCAATATTGG + Intergenic
1018586338 6:165364039-165364061 CAGAATAGTGAAAACAATATCGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021983944 7:26081210-26081232 CAAAATATGGACAGCCATATGGG - Intergenic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022950450 7:35333102-35333124 TAAAAAACTGAAAGCAACATGGG - Intergenic
1024560092 7:50636731-50636753 CAAAATAATTAGAGCCATATAGG + Intronic
1024623439 7:51183696-51183718 CAGTTCACTGATAGCAATATTGG + Intronic
1025846724 7:65205941-65205963 AAAAATAATAATAGCAATTTGGG + Intergenic
1025896970 7:65711809-65711831 AAAAATAATAATAGCAATTTGGG + Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027172226 7:75880640-75880662 CAAAGAACTGATGGTAATATTGG - Intronic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1027509936 7:79067745-79067767 CAAAATACTAAGAGCTATTTAGG - Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028573500 7:92318768-92318790 CTAGCTACTGATAGCCATATTGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1029171408 7:98631643-98631665 AAAGATACTGATAGCAAACTGGG + Intergenic
1029940719 7:104477995-104478017 CAAAATACAGAGAGCACTTTGGG - Intronic
1030633022 7:111916254-111916276 AAAAATACTGACATCAAAATGGG + Intronic
1030805891 7:113918606-113918628 CCAAATACAGAAAGCAATACTGG - Exonic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031611579 7:123833947-123833969 CATAATACTGATATAAAAATAGG - Intronic
1032281626 7:130507656-130507678 CAATATACTGATAGCAAAATGGG + Intronic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037219859 8:16505192-16505214 CTAAATACATATAGCAATACTGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040662040 8:49584823-49584845 CAAAATACTAAAAGTAACATGGG + Intergenic
1040692161 8:49952316-49952338 CAAAATCCTGATGAGAATATGGG + Intronic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1043370255 8:79583243-79583265 CAAGACACTGATAGTTATATGGG + Intergenic
1043390640 8:79788091-79788113 CAAAAAGTTGATAGCAACATGGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044159207 8:88892026-88892048 AAAATTAATGATAGCAATGTTGG - Intergenic
1044759388 8:95501821-95501843 CAAAGAACTGATAATAATATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045452047 8:102336799-102336821 CCAAATAGTGAAAGCAATAATGG - Intronic
1045724390 8:105155202-105155224 CAAAATACTGAGAAAAATACTGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046270982 8:111898119-111898141 CAAAATACTAATAAGAAAATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1049142765 8:140972008-140972030 CGAAATACTGATAGCAGTTCAGG - Intronic
1049647287 8:143741172-143741194 CAAACTACAGAAAGCAAAATGGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052531036 9:29684143-29684165 CAAAATAGGGATAGTCATATGGG + Intergenic
1052534310 9:29727853-29727875 CAAAAGAATCATAGAAATATGGG + Intergenic
1055400953 9:75923479-75923501 CAATATAGCTATAGCAATATAGG - Intronic
1056652475 9:88479099-88479121 CAAAAAAATGAAAGTAATATAGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057518930 9:95745587-95745609 AAAAATATTTATAGCAATTTAGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059007246 9:110417079-110417101 CAAAATACTTATGGAAAAATTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060450877 9:123737917-123737939 CAAAATACTGATATCCTTCTGGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1187249603 X:17584836-17584858 TAAAATATTGTTATCAATATAGG + Intronic
1187786539 X:22894197-22894219 GATAATACTGATGACAATATTGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189454202 X:41169763-41169785 CAAGATACTGAAAGTAATACAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189700178 X:43710499-43710521 CAGAATACTGAAAGCTGTATTGG - Intronic
1190118334 X:47640088-47640110 AAAAATACTGGTATAAATATTGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191120683 X:56900848-56900870 CAAAATAATGAGAGCTATTTAGG + Intergenic
1191724571 X:64266232-64266254 CAAAATACAGATTGAGATATGGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193584033 X:83298785-83298807 CAAAATAATGACAGCCATCTAGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193867324 X:86750881-86750903 CATAATACTGGTATCAATGTTGG + Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194269329 X:91791205-91791227 CAGAAAACTGTTAGCAAGATTGG - Intronic
1194851831 X:98880354-98880376 CAAAGTACTATTAGCATTATAGG - Intergenic
1194854178 X:98908129-98908151 CAAAATAATAAGAGCCATATAGG - Intergenic
1195612544 X:106884481-106884503 CTAAATACTGATTTCCATATTGG - Intronic
1195872714 X:109502627-109502649 CTGAATATTGATAGAAATATGGG - Intergenic
1196309384 X:114144493-114144515 CAAGATACTGAAAGAAAAATTGG - Intergenic
1197013979 X:121601945-121601967 CAAAATAATGAAAGCCATCTAGG - Intergenic
1197248135 X:124187634-124187656 AAAAATACTGATGGCCATAGAGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199309507 X:146306828-146306850 AAAACTGCTGATGGCAATATAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199775620 X:151008884-151008906 AAAAATATTGATAGCAATAGTGG + Intergenic
1200586549 Y:5012190-5012212 CAGAAAACTGTTAGCAAGATTGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1202190458 Y:22238085-22238107 CAAAAGACTTATAGTAAAATGGG - Intergenic