ID: 1096961265

View in Genome Browser
Species Human (GRCh38)
Location 12:55580319-55580341
Sequence GGGTAAACAAAATTTGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096961265_1096961271 4 Left 1096961265 12:55580319-55580341 CCCCTGGCAAATTTTGTTTACCC 0: 1
1: 0
2: 2
3: 17
4: 151
Right 1096961271 12:55580346-55580368 CCCTTCCCAGCTCAATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096961265 Original CRISPR GGGTAAACAAAATTTGCCAG GGG (reversed) Intergenic
902163348 1:14550332-14550354 GGGGAAAAAAAATTAGCCAAAGG + Intergenic
904588390 1:31593090-31593112 TGGTAAACCGAATATGCCAGTGG + Intergenic
904972014 1:34426611-34426633 AGGTCAACAGAATTTGCCAATGG + Intergenic
907175499 1:52518210-52518232 GGATAAACAAAATGTGGCATTGG + Intronic
911522970 1:98950627-98950649 GTGTAACCAATGTTTGCCAGTGG - Intronic
912907896 1:113726461-113726483 GAGTAGACACAATTTGACAGTGG + Exonic
914193693 1:145432273-145432295 GGGTAGAAGAAAGTTGCCAGCGG - Intergenic
914475022 1:148015163-148015185 GGGTAGAAGAAAGTTGCCAGCGG - Intergenic
914845148 1:151279673-151279695 TGGAAAAAAAAATTAGCCAGGGG - Intergenic
917521779 1:175753678-175753700 TAGGAAACAAATTTTGCCAGAGG + Intergenic
920333014 1:205225609-205225631 GGCTAATGAAAATTTGCCATTGG + Intergenic
921553481 1:216568249-216568271 GGCTAAATCAAACTTGCCAGAGG + Intronic
921982960 1:221278118-221278140 GGGTAAACAAAATAGGGAAGTGG - Intergenic
923031314 1:230251067-230251089 GGGTAAAAATAATTTGCATGGGG - Intronic
1064713952 10:18156123-18156145 GGGTAAAAAGCATTTACCAGTGG + Intronic
1064748955 10:18506324-18506346 AGGAAAACAATATTTCCCAGTGG - Intronic
1068021446 10:51590383-51590405 GGGGAAAGAAAATTAGCCAGAGG - Intronic
1068156835 10:53210273-53210295 AGATGAACAAAATTTGCCAGTGG - Intergenic
1073073883 10:100811369-100811391 GGACAAACAGAATTTGCTAGAGG + Intronic
1078350281 11:10587279-10587301 TGGTAAACAATATTTGAAAGTGG + Intronic
1083214836 11:61211988-61212010 TGGAAAACTAATTTTGCCAGTGG + Intronic
1083217720 11:61230817-61230839 TGGAAAACTAATTTTGCCAGTGG + Intronic
1083220716 11:61250567-61250589 TGGAAAACTAATTTTGCCAGTGG + Intronic
1083480620 11:62943149-62943171 GGAAAAACAAAATAGGCCAGTGG - Intronic
1083863282 11:65438028-65438050 GGGTACACAGAACTTCCCAGTGG - Intergenic
1085076785 11:73598367-73598389 GAGTCTACAAAATTCGCCAGCGG - Intergenic
1085775731 11:79364887-79364909 GGATAATCAAAATTAGCTAGAGG + Intronic
1087205088 11:95386096-95386118 GGGAAAATAAAATTTCCAAGTGG + Intergenic
1088511609 11:110581116-110581138 TGGTAAAGAAACTTGGCCAGGGG - Exonic
1089164319 11:116462887-116462909 AGGTTAAAAAAATTTGCCAAGGG + Intergenic
1093208023 12:16274239-16274261 TGTTAAAGAACATTTGCCAGTGG - Intronic
1094135388 12:27119968-27119990 AGGTAAACAAAAGTAGCCAAGGG - Intergenic
1094280296 12:28729974-28729996 TGGTATTCAGAATTTGCCAGTGG + Intergenic
1095205437 12:39434555-39434577 GGGAAAACCAAATTTATCAGGGG + Intronic
1095941003 12:47726741-47726763 GGGCAAGCAAACTTTGCAAGGGG + Intergenic
1096961265 12:55580319-55580341 GGGTAAACAAAATTTGCCAGGGG - Intergenic
1100007173 12:89908512-89908534 GGCTAAGCAAAATTTTCCGGGGG + Intergenic
1102938475 12:116917249-116917271 GGTTAAACAAAACCTGTCAGTGG + Intronic
1107128268 13:36868166-36868188 GTGTACACAAAAATTGCCAGTGG + Intronic
1111148385 13:84215403-84215425 AGGGAAGCAAAATTTGTCAGAGG - Intergenic
1112891548 13:104239528-104239550 GGCTAAACAAATAATGCCAGTGG + Intergenic
1113142002 13:107163498-107163520 GCGTAAACAAACTTTAGCAGTGG + Exonic
1113894334 13:113754220-113754242 GGGAAAATAGAATTTGCCACAGG - Intergenic
1114823981 14:26054666-26054688 GCTAAAACAAACTTTGCCAGAGG - Intergenic
1115432155 14:33331687-33331709 GCATAAACAAAATCTGACAGAGG + Intronic
1117143688 14:52815153-52815175 GGGCAAAGAACAATTGCCAGAGG - Intergenic
1119447173 14:74675409-74675431 GAGTAAAGAAATTTTGGCAGAGG - Intronic
1119819173 14:77599259-77599281 GGTTAAACAAAATTTACCAGGGG + Intronic
1119983373 14:79107660-79107682 GTGCTAACAACATTTGCCAGTGG + Intronic
1120297740 14:82665018-82665040 GGGGAATCAAAATTTTACAGTGG + Intergenic
1120733651 14:88029710-88029732 GGTTAAAGTAAATTAGCCAGCGG - Intergenic
1121068783 14:90996901-90996923 GGGTAAACAAATTTTCTTAGTGG - Intronic
1130681970 15:86004924-86004946 GGGTGAACAAGCTTTTCCAGTGG + Intergenic
1133517625 16:6524986-6525008 GGGTAAACATAAATTTTCAGAGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137879098 16:52027976-52027998 AGGAAAAAAAAATTTCCCAGAGG + Intronic
1138025997 16:53522948-53522970 GGGTAAAAAAGTTTTGCCAGGGG - Intergenic
1141302151 16:82827007-82827029 GGATAAGCAAAACATGCCAGGGG - Intronic
1142288474 16:89181482-89181504 TGGTAAAATAAATTAGCCAGCGG + Intronic
1142769087 17:2083877-2083899 GGGTAAGCACAGTTTCCCAGAGG + Intronic
1151900143 17:77007011-77007033 GGGAATGCAAAATTAGCCAGAGG - Intergenic
1162476084 19:10900151-10900173 AAATAAACAAAATTAGCCAGGGG + Intronic
1164059576 19:21658926-21658948 GTATAAACAAAATTTGCATGGGG - Intergenic
1165125188 19:33590116-33590138 GGACAAAGAAAATTTGGCAGGGG + Intergenic
925398498 2:3554187-3554209 GTGAAAACAAAATGTGGCAGTGG - Intronic
925417795 2:3683967-3683989 GGGTAAACAAAATGTGGTAGTGG - Intronic
925761912 2:7193003-7193025 GGGAAAAAAAAATATGCAAGAGG + Intergenic
926040048 2:9665755-9665777 GGAAAAAGAAAATGTGCCAGTGG + Intergenic
927580630 2:24242974-24242996 GGGAAAACAAAATGTTCAAGAGG - Intronic
933022009 2:77205992-77206014 AGGTAAAATAAATTTGCCAGGGG - Intronic
934020721 2:87948675-87948697 GGGTTAACAATAATTGCCACCGG - Intergenic
934746896 2:96765283-96765305 AAATAAACAAAATTAGCCAGGGG - Intronic
935382605 2:102467793-102467815 GGGAATACAAACTTTGCAAGGGG - Intergenic
938914098 2:135917264-135917286 GGGTAAACACAATTGGCCACAGG + Intronic
938953213 2:136276292-136276314 GGCCAATCAAAATATGCCAGTGG - Intergenic
940479909 2:154214982-154215004 GGGAAAACAATATTTTTCAGAGG + Intronic
942985926 2:182142220-182142242 TGGAAAATGAAATTTGCCAGCGG - Exonic
943497022 2:188633102-188633124 TGGAAAACACAGTTTGCCAGTGG + Intergenic
945101191 2:206263588-206263610 CAGGAAACAAAATTTTCCAGGGG + Intergenic
1172260843 20:33564046-33564068 GGGGAAAAACAATTTTCCAGCGG - Intronic
1174312253 20:49666698-49666720 GGAAAAACAAAATGTGCCAAAGG + Intronic
1177091643 21:16776789-16776811 GGGTGAACACAAGTTGCCTGGGG - Intergenic
1177546322 21:22562898-22562920 GGAAAAAAAAAATTAGCCAGAGG - Intergenic
1182687800 22:32134273-32134295 GAGTAAACAAAATTTTCTACTGG - Intergenic
949616463 3:5758934-5758956 GGGAAAATAAAATGTCCCAGCGG - Intergenic
951050465 3:18087933-18087955 AGGTAAACAAAATTTGGGAAAGG + Intronic
951492084 3:23282213-23282235 AGCAAAACAAAATTTCCCAGAGG - Intronic
951603677 3:24407074-24407096 GAGAAAACAAACTTTGGCAGTGG + Intronic
954744127 3:52777447-52777469 GAGGAATCAAAATTTGGCAGTGG - Intergenic
955160184 3:56457812-56457834 GGGTAAATGGAATTAGCCAGAGG - Intronic
956401612 3:68885566-68885588 GGGTATTCAAAATTTAACAGAGG + Intronic
956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG + Intergenic
958257584 3:91342631-91342653 GCCTCAAGAAAATTTGCCAGTGG - Intergenic
959514593 3:107250832-107250854 GGGCAAACAAAATTAGAAAGTGG - Intergenic
960240751 3:115339057-115339079 GGGTAAGCCACACTTGCCAGAGG + Intergenic
961097769 3:124172632-124172654 AGGAGAAGAAAATTTGCCAGGGG + Intronic
961903895 3:130242496-130242518 AAGAAAACAAAATTGGCCAGGGG - Intergenic
963457694 3:145566022-145566044 GGGGAAAGTAAATTTGCTAGTGG - Intergenic
964017022 3:151960344-151960366 GGGTTGACAAAATATACCAGTGG - Intergenic
964389702 3:156184499-156184521 GGCTAAAAAGAAGTTGCCAGTGG + Intronic
965683732 3:171279151-171279173 AGGTAAACAAATTTTGAAAGTGG + Intronic
967268490 3:187713345-187713367 GGGTACACAAATGTTACCAGTGG + Intronic
967534949 3:190591421-190591443 GGGTAAACAATATATGATAGTGG - Intronic
967821527 3:193843308-193843330 TGGTGAACAAGATTGGCCAGTGG - Intergenic
970236550 4:13964627-13964649 GGGGAGACAAAATTTGCATGTGG + Intergenic
970589188 4:17544737-17544759 GAGGAAACAAAATTAGCCATGGG - Intergenic
970981428 4:22103103-22103125 GTATACACAAAATTTGCCAAGGG - Intergenic
971962787 4:33510618-33510640 GGGTAAATTATATTTTCCAGTGG - Intergenic
978080458 4:104583861-104583883 GGGTAAAGAAAATTTCAGAGAGG - Intergenic
979903860 4:126258691-126258713 AGATAAACAAAATTTTACAGTGG - Intergenic
981778403 4:148397017-148397039 GGAAAAATCAAATTTGCCAGAGG + Intronic
981790232 4:148527898-148527920 AGGTCAACAAAATTTGGCATGGG - Intergenic
982652891 4:158109095-158109117 GGGTCAACAAAGCTTCCCAGAGG - Intergenic
983460293 4:168018317-168018339 GGGTAAACAAAAATTGCATGTGG - Intergenic
985011867 4:185591211-185591233 GGGAAAACAATATTTTCTAGGGG - Intronic
986028077 5:3869533-3869555 GGATAAACAAAATGTGCCCATGG + Intergenic
986420094 5:7571626-7571648 GGACAAACAAAATTTGAGAGGGG - Intronic
986697356 5:10369613-10369635 GGGTAAAGGATATTTGCAAGGGG - Intronic
988414991 5:30935201-30935223 TGGAAAAAAAAATTTTCCAGTGG - Intergenic
988558877 5:32262199-32262221 GGGTAAACACAAATTTCCACAGG + Intronic
989642095 5:43592763-43592785 AGGGAAACAAAATGTGCCAGTGG - Intergenic
992640686 5:78766212-78766234 GGGTAAACAAAACTTGCCTGAGG + Intronic
995348764 5:111151214-111151236 AGGTCAACAAAATTTGACAATGG + Intergenic
996370886 5:122751480-122751502 GGGTGAACACAATTAGCCAGAGG - Intergenic
997063516 5:130535470-130535492 GGGCCAATAAGATTTGCCAGTGG + Intergenic
1000809962 5:165849015-165849037 GGATAAACAATATTTGTGAGGGG + Intergenic
1000845206 5:166271069-166271091 TGGGAAACAAAACTTACCAGAGG + Intergenic
1008960964 6:57264841-57264863 GGACAAACAAGATCTGCCAGTGG - Intergenic
1009186204 6:60577618-60577640 GCCTCAAGAAAATTTGCCAGCGG + Intergenic
1009991567 6:70848869-70848891 TGGTAAACACAAGTTCCCAGTGG - Intronic
1015275986 6:131383895-131383917 GGGAAAACAAGATCTGACAGGGG + Intergenic
1016948394 6:149556084-149556106 GGATAAAGAAAATGTGGCAGTGG + Intergenic
1017049957 6:150381110-150381132 GTGTAAACAAAACTGGCCATAGG - Intronic
1018217122 6:161539285-161539307 AGGTAAATTAAATTTCCCAGTGG + Intronic
1020157751 7:5740552-5740574 AGTTAAATAAAATTTTCCAGTGG - Intronic
1021868817 7:24983196-24983218 AAGAAAACAAAATTTGCCTGAGG - Intergenic
1022170358 7:27822229-27822251 GGGTAAACAAAATGTGGGACAGG - Intronic
1027155398 7:75763908-75763930 CGGGAAACAAAAGGTGCCAGAGG + Intergenic
1031423778 7:121581285-121581307 AGGGAAACACAGTTTGCCAGAGG - Intergenic
1041293009 8:56325142-56325164 GGGGAAAAAAAATTTGTTAGAGG - Intergenic
1042470763 8:69185309-69185331 TGCTAAACACTATTTGCCAGTGG - Intergenic
1044070096 8:87749434-87749456 ACATAAACAAAAGTTGCCAGGGG + Intergenic
1046758934 8:118000480-118000502 GTGTAAACGAAAGTTGCCCGAGG + Intronic
1047037713 8:120957210-120957232 GGGAAAAGGAAATTTGACAGAGG + Intergenic
1047585633 8:126268974-126268996 GTGTAAACAAAACTTGCAGGAGG - Intergenic
1048211807 8:132460466-132460488 GGTTAAGCAAAATATGGCAGTGG - Intronic
1050485931 9:6134564-6134586 TGGTAAACAAAAATTGCTAATGG + Intergenic
1051623360 9:19075009-19075031 GGATAAACAAAATGTGGTAGAGG + Intronic
1053300942 9:36948994-36949016 GATTAAACAAAGTTTGACAGAGG - Intronic
1053850398 9:42284902-42284924 GGGTAAAAAATATTGGCCATGGG - Intergenic
1058973569 9:110105057-110105079 GGAGAAACAAAGTTGGCCAGAGG + Intronic
1059794465 9:117677329-117677351 AGGTAAACAAGATTTGGAAGAGG + Intergenic
1060743821 9:126116924-126116946 GGGTAACCAAAATGTTCCGGGGG - Intergenic
1186389209 X:9141870-9141892 GGGTAAATAAAATTTTGAAGTGG + Intronic
1186443698 X:9607697-9607719 GGGCAACCAAAATTTCCCAAGGG + Intronic
1188263855 X:28046125-28046147 GGGTAAAAGAAATTTGGCAGTGG - Intergenic
1191029809 X:55957176-55957198 GGTTAAACGATATTTGCCAGGGG - Intergenic
1191215412 X:57928132-57928154 GGGTTAACTAAATTTGTCATGGG - Intergenic
1191922069 X:66267613-66267635 GTGTCAAGAAAATTTGCCAGAGG + Exonic
1194019639 X:88670728-88670750 TGGAAAACAAAATTTAGCAGGGG + Intergenic
1199123803 X:144090452-144090474 GGGTTAACAATAATTGCCACCGG + Intergenic
1200735501 Y:6789469-6789491 GGGTAATCAATATTTGGCACTGG + Intergenic
1200836610 Y:7738547-7738569 GGGCAAGGAAAATCTGCCAGAGG - Intergenic
1200846400 Y:7835521-7835543 GGCTAAACACCATCTGCCAGAGG + Intergenic
1202241656 Y:22777107-22777129 GGGAAAACAAAAAATGGCAGGGG - Intergenic
1202276129 Y:23121900-23121922 AGGTAAACAAAATTTGCAAACGG + Intergenic
1202289899 Y:23298791-23298813 AGGTAAACAAAATTTGCAAACGG - Intergenic
1202394639 Y:24410851-24410873 GGGAAAACAAAAAATGGCAGGGG - Intergenic
1202429122 Y:24755622-24755644 AGGTAAACAAAATTTGCAAACGG + Intergenic
1202441669 Y:24914467-24914489 AGGTAAACAAAATTTGCAAACGG - Intergenic
1202476145 Y:25259241-25259263 GGGAAAACAAAAAATGGCAGGGG + Intergenic