ID: 1096964398

View in Genome Browser
Species Human (GRCh38)
Location 12:55613852-55613874
Sequence ACAAAGACATGAATATCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096964395_1096964398 6 Left 1096964395 12:55613823-55613845 CCAGCCCATATTCAAGAAGAGGT No data
Right 1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG No data
1096964393_1096964398 12 Left 1096964393 12:55613817-55613839 CCTAGTCCAGCCCATATTCAAGA No data
Right 1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG No data
1096964397_1096964398 1 Left 1096964397 12:55613828-55613850 CCATATTCAAGAAGAGGTGAGCA No data
Right 1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG No data
1096964396_1096964398 2 Left 1096964396 12:55613827-55613849 CCCATATTCAAGAAGAGGTGAGC No data
Right 1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096964398 Original CRISPR ACAAAGACATGAATATCAGA AGG Intergenic
No off target data available for this crispr