ID: 1096967734

View in Genome Browser
Species Human (GRCh38)
Location 12:55641828-55641850
Sequence GGCTCTCGGGACGACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096967726_1096967734 27 Left 1096967726 12:55641778-55641800 CCACGGCACTGGCAGCACAGTTC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
1096967728_1096967734 -7 Left 1096967728 12:55641812-55641834 CCCAGTGCCTACAGCTGGCTCTC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
1096967729_1096967734 -8 Left 1096967729 12:55641813-55641835 CCAGTGCCTACAGCTGGCTCTCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096967734 Original CRISPR GGCTCTCGGGACGACAGGCC TGG Intergenic
902481309 1:16713365-16713387 GGCTGACGTGATGACAGGCCGGG + Intergenic
902955263 1:19921017-19921039 GGCTCTAGGAAGGACAGGTCAGG - Intronic
903321035 1:22543322-22543344 GGCTCTCGGGCGGACAGCCCAGG - Intergenic
904042355 1:27592260-27592282 GGCTCTGTGGATGACAGGCAGGG - Intronic
913053850 1:115139590-115139612 GGCCCTTGGCACGACAGGCGGGG - Intergenic
915616807 1:157045665-157045687 GCCGCTCGGGACGCCAGGCTCGG + Intergenic
917927284 1:179799894-179799916 GGTTCTCAGGAAGAGAGGCCTGG + Intronic
921140966 1:212306016-212306038 TGCTCTCAGGACAACTGGCCAGG - Intronic
923744330 1:236686529-236686551 TCCTCTCGGGGCGACACGCCTGG - Exonic
1065614124 10:27502849-27502871 GGATCTCGGGACCCCAGGGCAGG + Intergenic
1065780600 10:29162940-29162962 GGCTCTGGGGTTGACAGCCCTGG + Intergenic
1071532287 10:86399908-86399930 GGCGCTCGGGCCTCCAGGCCTGG + Intergenic
1076742512 10:132493805-132493827 GGCTCTTGGGATAACTGGCCAGG - Intergenic
1077141797 11:1028056-1028078 ACCTCTGGGGATGACAGGCCCGG + Exonic
1084446310 11:69205600-69205622 GGCTCTCTGGAACCCAGGCCTGG - Intergenic
1085269508 11:75262026-75262048 GGCTCTCAGGACAAAAGGCTTGG + Intergenic
1088907506 11:114165714-114165736 GGCTTCCGGGAGAACAGGCCTGG + Intronic
1096141311 12:49245034-49245056 GGCTCTGAGTAAGACAGGCCTGG - Intronic
1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG + Intergenic
1100442156 12:94627241-94627263 GGCTTTGGGGGCAACAGGCCTGG - Intronic
1103599636 12:122046266-122046288 GGGTCTGGGGAGGGCAGGCCAGG + Intronic
1104844950 12:131841960-131841982 GGCTCTGGGGACGTCAGGGGTGG - Intronic
1106408657 13:29496103-29496125 GACTCTCAGGACCACAGGCTGGG - Intronic
1109157145 13:58925178-58925200 GGCTCACAGGATGACAGGCTGGG - Intergenic
1110165002 13:72431122-72431144 GGCCCTAGGGAAGACAGGCCCGG + Intergenic
1122982191 14:105196863-105196885 GGGACTCGGGACCGCAGGCCGGG + Intergenic
1124241912 15:28035452-28035474 AGCTCTCTGGATCACAGGCCAGG - Intronic
1128149661 15:65355227-65355249 GGCTCTCGGGGCCCCAGGCTCGG - Intronic
1132229903 15:100173832-100173854 GGCTCTTTGGAGTACAGGCCAGG + Intronic
1132677673 16:1127389-1127411 GGGTCTCAGGAGGACAGGGCCGG - Intergenic
1136069366 16:27778766-27778788 GGGACTCGGGAGGACAGCCCTGG + Exonic
1144586550 17:16491304-16491326 CGCTCTCGGGAAGCCAAGCCAGG + Intronic
1145991237 17:29080617-29080639 GGCTCTGGCGAAGACAGGGCTGG - Intronic
1148451098 17:47778319-47778341 GGCTCTCGGTGCAGCAGGCCGGG + Intergenic
1148754046 17:49963218-49963240 GGCTCTTGGGTCCCCAGGCCTGG - Intergenic
1150823774 17:68457267-68457289 TGCTCTCAGGACGACACCCCTGG + Intronic
1151370829 17:73645176-73645198 GGCTCTCTGGACGCCGAGCCCGG - Intergenic
1151954251 17:77372828-77372850 GGCTCTTGAGCCCACAGGCCGGG + Intronic
1152876570 17:82789864-82789886 GGCTCCCGGGTAAACAGGCCAGG - Intronic
1152932436 17:83116689-83116711 GTCTCTGAGGACGACAGGGCCGG - Intergenic
1153799762 18:8658962-8658984 GGCTCTCGGGCAGAGTGGCCAGG + Intergenic
1159105311 18:63997427-63997449 GGCTCATTGGACGACATGCCTGG - Intronic
1160401085 18:78612021-78612043 GGTTCTGGGGAGCACAGGCCGGG - Intergenic
1160581845 18:79887634-79887656 AGCCCTCGGGACGCCAGGCTTGG - Intronic
1161063996 19:2228673-2228695 GGCTCACGGGGTGCCAGGCCAGG + Intronic
1161315624 19:3615990-3616012 GGCTCCCAGGAAGCCAGGCCAGG + Intronic
1161709898 19:5841941-5841963 GGCCCTCGGCAGGCCAGGCCAGG - Intergenic
1161713666 19:5863829-5863851 GGCTCACGGGAGGCCAGGCCAGG - Intergenic
1161716107 19:5877093-5877115 GGCCCTCGGCAGGCCAGGCCAGG - Intronic
1162481214 19:10928182-10928204 GGGTCTGGGGACGAGAGGCTCGG + Intronic
1163697288 19:18770277-18770299 TGCTCGAGGGACGAAAGGCCCGG - Intronic
1164627190 19:29737503-29737525 GGCTCCCAGGACCACATGCCAGG + Intergenic
1166473757 19:43102693-43102715 TGCTCTCGGTATGGCAGGCCAGG - Intronic
1168419316 19:56190857-56190879 GGCTCTGGGGATGACAGTCCTGG + Exonic
1168423770 19:56222611-56222633 GGCTCTGGGGATGTCAGTCCTGG + Exonic
1202715347 1_KI270714v1_random:39276-39298 GGCTGACGTGATGACAGGCCGGG + Intergenic
925299976 2:2804795-2804817 GGCTCAGAGGACGACACGCCGGG - Intergenic
926129296 2:10290850-10290872 GGCTTTTGGGAAGACAGTCCTGG - Intergenic
927965440 2:27264880-27264902 GGCTCTGGGTACGTCGGGCCCGG + Intronic
928124300 2:28605310-28605332 GGCTCTTGGGATGGCAGCCCAGG - Intronic
935097288 2:99957823-99957845 GGGTCTCTGGATGGCAGGCCAGG + Intronic
937122815 2:119452442-119452464 GGATCTGGGGACATCAGGCCTGG + Intronic
948496405 2:238352535-238352557 GGCTGTGGGGACGGGAGGCCAGG + Intronic
1168997204 20:2142336-2142358 GCCTCTTGGGAGGACTGGCCAGG + Intronic
1173242128 20:41306448-41306470 GGCTTTGGGGAAGAAAGGCCTGG - Intronic
1173895214 20:46545836-46545858 GGCTCTGGGCCCCACAGGCCAGG - Exonic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1183481935 22:38070014-38070036 GGCTCTGGGGAACCCAGGCCTGG + Intronic
1183750281 22:39716138-39716160 GGCTCTCGGGAGGGCAGGCTGGG - Intergenic
1184035102 22:41914505-41914527 GGCGCCCGGCACGACAGCCCCGG - Exonic
1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG + Intergenic
1185266590 22:49907203-49907225 GGCTCTGAGGGCGACAGGTCAGG - Intronic
1185300030 22:50074705-50074727 GGGACTCGGGAAAACAGGCCTGG + Intronic
954389993 3:50263729-50263751 GGCTCTCAGGAGGGCAGGCTTGG + Intergenic
964092779 3:152895655-152895677 GGCTCTCAGGAGTACTGGCCTGG - Intergenic
968705155 4:2074220-2074242 GGCCCTCGGGAGGGCAGGCAGGG + Intronic
969299130 4:6287212-6287234 GGCCCCCGGCACAACAGGCCTGG + Intronic
969313340 4:6366967-6366989 GGCTCTGGGCAGGACAGGGCGGG + Intronic
969859005 4:10021224-10021246 GGCTGTGGGGAAGGCAGGCCTGG - Intronic
970602630 4:17652598-17652620 GGGTCTCGGGCTCACAGGCCAGG - Intronic
970602640 4:17652628-17652650 GGCTCTCAGGCACACAGGCCAGG - Intronic
973835041 4:54801066-54801088 GGCTTTGGGGAGGACAGGGCAGG + Intergenic
978493434 4:109333380-109333402 GGCTCTGGAAAGGACAGGCCTGG + Intergenic
984639189 4:182144309-182144331 GGCCCGCGGGACGCCCGGCCAGG - Intronic
985719338 5:1481164-1481186 GGCTCTGGGGACCTCAGGCTGGG - Intronic
985878109 5:2616090-2616112 GGCTCTCTGGATGAAAGTCCTGG - Intergenic
986243526 5:5983387-5983409 GGCTCTTGGGATGAGTGGCCAGG - Intergenic
992910856 5:81394359-81394381 GGCTCCCGGGTAGACAGGTCTGG + Intergenic
1011193840 6:84763178-84763200 GGCTCTTGGGACCAGAGTCCGGG - Intronic
1012401878 6:98848080-98848102 GGCTCCCCAGACGCCAGGCCTGG - Intergenic
1015863188 6:137701824-137701846 TGCTCTCAGGACAACAGGCCCGG - Intergenic
1019902058 7:4028664-4028686 AGCTCTCTGGAGGACAGGCTGGG + Intronic
1027221399 7:76216525-76216547 TTCTCTCAGGAAGACAGGCCAGG - Intronic
1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG + Intronic
1029384369 7:100233945-100233967 GGATCTCGGGCCCTCAGGCCTGG - Intronic
1029487543 7:100852724-100852746 GGCTACCGGGATGCCAGGCCTGG - Intronic
1033249022 7:139743024-139743046 GGCTCTCTGGAGGACAGTCTAGG + Intronic
1037710446 8:21351256-21351278 GGCTCTCGGGAGCACAGCCTGGG - Intergenic
1037865721 8:22440992-22441014 GGCGCTCGGGGCGGGAGGCCCGG + Intronic
1042672921 8:71283984-71284006 GGCTTTAGAGAAGACAGGCCTGG - Intronic
1044213617 8:89580931-89580953 GGCTCTCTGGACTGGAGGCCTGG - Intergenic
1049282851 8:141759356-141759378 GGCTCTGGGGACGCCTGGCTCGG + Intergenic
1053479383 9:38404733-38404755 GGCTCTCAGAGCAACAGGCCAGG + Intergenic
1060272882 9:122159600-122159622 GGCTATCCGGAGGACAGGCAAGG - Intronic
1061397495 9:130351419-130351441 GCCTCCCGGAAGGACAGGCCTGG - Intronic
1062239277 9:135526990-135527012 GGCTCCCCGGAGGACAGGACTGG - Intergenic
1185447635 X:267934-267956 GGCTCACGGGGCCTCAGGCCGGG - Intergenic
1190452871 X:50598314-50598336 CACTCTCTGGACGACTGGCCCGG - Exonic
1190713391 X:53085006-53085028 GGTTCCCGTGACGACGGGCCTGG - Exonic
1195941018 X:110168106-110168128 GGCACCCGGGACAACAGGACTGG + Intronic