ID: 1096968084

View in Genome Browser
Species Human (GRCh38)
Location 12:55644484-55644506
Sequence GTGGTTGGCTAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096968084_1096968087 -5 Left 1096968084 12:55644484-55644506 CCTGCAGCATCCTAGCCAACCAC No data
Right 1096968087 12:55644502-55644524 ACCACCCCTGTGCTATGACCTGG No data
1096968084_1096968096 26 Left 1096968084 12:55644484-55644506 CCTGCAGCATCCTAGCCAACCAC No data
Right 1096968096 12:55644533-55644555 TCTGGCCTCTCAGCTTCTTTTGG No data
1096968084_1096968092 2 Left 1096968084 12:55644484-55644506 CCTGCAGCATCCTAGCCAACCAC No data
Right 1096968092 12:55644509-55644531 CTGTGCTATGACCTGGCCTGTGG No data
1096968084_1096968093 8 Left 1096968084 12:55644484-55644506 CCTGCAGCATCCTAGCCAACCAC No data
Right 1096968093 12:55644515-55644537 TATGACCTGGCCTGTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096968084 Original CRISPR GTGGTTGGCTAGGATGCTGC AGG (reversed) Intergenic
No off target data available for this crispr